The Laboratory of Michael McVoy
| |
CMV Cafe:
The Laboratory of Michael McVoy |
|
VIRGINIA COMMONWEALTH UNIVERSITY |
 |
How to Contact Us
RESEARCH INTERESTS
Mailing Address:
Return to Top
Michael A. McVoy
Department of Pediatrics
Medical College of Virginia campus of
Virginia Commonwealth University
P.O. Box 980163 MCV Station
Richmond VA 23298-0163
office phone:
804-828-1739
lab phone: 804-828-2291
division secretary: 804-828-0132
fax: 804-828-6455
e-mail: mmcvoy@vcu.edu
Federal
Express Address:
Michael McVoy
Sanger Hall Room 12-026
1101 East Marshall Street
Richmond VA 23298
Jianben Wang, M.D.
Research Associate (1996)
M.D.
Harbin Medical Institute, Harbin P.R. China
M.S. Shanxi Medical Institute,
Taiyuan P.R. China
Anne Sauer
Ph.D. student (2003), Molecular Biology and
Genetics
B.S. University of Alabama (Physical
Education, Health, and Recreation)
B.S. Virginia Commonwealth University
(Biology)
Megan Reeves
Ph.D. Student (2004), Department of Microbiology & Immunology
B.S. University of Florida (2002)
Ian McVoy
Grade 5, Fox
Elementary, Richmond Virginia
click here to view: Ian1 , Ian2
Juan
Lacayo, Ph.D.
Ph.D.
student, Department of Microbiology & Immunology (1999-2003)
B.S.
Virginia Commonwealth University
Currently: Post-doctoral Fellow, NIH
Erin Douglass
Laboratory Specialist (2003-2004)
B.S. Duke University (2003)
Currently: Medical College of Virginia, class of 2008
Cristine Howard
Laboratory Specialist
(2001-2003)
B.S.
College of William and Mary
M.S.
College of William and Mary
Currently:
Medical College of Virginia, class of 2007
Melissa
Mondello
Laboratory Specialist (2002-2003)
B.S. University of Richmond
Currently: Medical College of Virginia, class
of 2007
Will
Bierach
M.S.
Student (2001-2002)
B.S. Campbell University
Currently: Biogen
Carlos Berbes
Ph.D. student, Department of Microbiology & Immunology (1998-2001)
B.S. Virginia Commonwealth University
M.S. Medical College of Virginia Campus of Virginia Commonwealth
University
Frederic Schynts, Ph.D.
Visiting Ph.D. student from the University of
Liege, Belgium (2001 – 2002)
Ph.D. University of Liege, Belgium.
Currently: Director, Animal
Virology Division, Center for Rural Economic Development, Belgium
Stephanie Siegmund
Field Experience Student (2005 - 2006)
Governor's School for Government and
International Studies
Jessica Abbate
Field Experience Student (1998 - 1999)
Governor's School for Government and
International Studies
B.S. The University of Virginia (2003)
Dipti Ramnarain
Field Experience Student (1998 - 1999)
Governor's School for Government and
International Studies
B.S. The College of William and Mary
(2003)
Yulin Liu
Visiting Scientist (2000 - 2001)
M.D. Xinjiang Medical University,
Urumuqi P.R. China
B.S. Xinjiang Medical University,
Urumuqi P.R. China
Jae Kyun Hur
Visiting Scientist (1996 - 1997)
M.D. Catholic Medical College, Seoul Korea
Ph.D. Catholic Medical College, Seoul Korea
Anupam Bapu Jena
(1995 - 1996)
Governor's School for Government
and International Studies
B.S. Massachusetts Institute of Technology
McVoy, M. and S.P. Adler.
1991. Analysis of human cytomegalovirus DNA replicative intermediates:
DNA forms not predicted by the rolling circle model. In M.P
Landini (ed.), Progress in cytomegalovirus research. Elsevier Science
Publishers, Amsterdam
Abstract
Brown, J. C. , M. A.
McVoy and F. L. Homa. 2002. Packaging DNA into
Herpesvirus Capsids. In A. Holzenburg and E. Bogner
(ed.), Structure-Function Relationships of Human Pathogenic
Viruses. Kluwer Academic/Plenum Publishers, London. Abstract
Schynts, F., F. Meurens, B. Muylkens, A. L. Epstein, M. McVoy, and E. Thiry. 2002. Réplication, clivage-encapsidation et recombinaison de I’ADN des herpèsvirus. Virologie 6:353-52. Abstract
Schleiss, M. R. and M. A. McVoy.
2004. Overview of congenitally and perinatally acquired
cytomegalovirus infections: recent advances in antiviral therapy.
Expert Review of Anti-infective Therapy, 2:89-103.
Selected Journal Publications
McVoy, M. and S.P. Adler. 1994. Human cytomegalovirus DNA replicates after early circularization by concatemer formation and inversion occurs within the concatemer. Journal of Virology, 68:1040-1051 Abstract
McVoy, M.A., Nixon, D.E., and
S.P. Adler. 1997. Circularization and cleavage of guinea
pig cytomegalovirus genomes.
Journal of Virology, 71:4209-4217 Abstract
McVoy, M.A., Nixon, D.E.,
Adler, S.P., and E.S. Mocarski. 1997. Sequences within the
herpesvirus-conserved pac1 and pac2 motifs are required
for cleavage and packaging of the murine cytomegalovirus genome.
Journal of Virology, 72:48-56 Abstract
McVoy, M.A. and E.S. Mocarski. 1999. Tetracycline regulation of
reporter gene expression within the human cytomegalovirus genome.
Virology 258:295-303. Abstract
McVoy, Michael A., Daniel E. Nixon, Jay K. Hur, and Stuart P. Adler. 2000. The ends on herpesvirus DNA replicative concatemers contain pac2 cis cleavage/packaging elements and their formation is controlled by terminal cis sequences. Journal of Virology, 74:1587-1592. Abstract
McVoy, M.A. and D. Ramnarain. 2000. The machinery to support genome segment inversion exists in a herpesvirus which does not naturally contain invertible elements. Journal of Virology, 74:4882-7. Abstract
Abbate, J., J. C. Lacayo, M. Prichard, G. Pari, and M. A. McVoy. 2001. A bifunctional protein conferring enhanced green fluorescence and puromycin resistance. BioTechniques, 31: 340-347. Abstract
Nixon, D. E. and M. A. McVoy. 2002. Terminally repeated sequences on a herpesvirus genome are deleted following circularization but are reconstituted by duplication during cleavage and packaging of concatemeric DNA. Journal of Virology, 76:2009-2013. Abstract
DeWire, S., M. A.
McVoy and
B. Damania. 2002. Kinetics of expression of rhesus monkey
rhadinovirus
(RRV) and characterization of a polycistronic transcript encoding RRV
Orf50/Rta,
RRV R8, and R8.1 genes. Journal of Virology, 76:9819-9831.
Abstract
Mark R. Schleiss, David I.
Bernstein, Michael A. McVoy, Greg Stroup, Fernando Bravo, Blaine
Creasy, Alistair McGregor, Kristin Henninger, and Sabine Hallenberger.
2005. The Nonnucleoside Antiviral, BAY 38-4766, Protects Against
Cytomegalovirus Disease and Mortality in Immunocompromised Guinea
Pigs. Antiviral Research, 65:35-43. Abstract
Michael A. McVoy and Daniel E. Nixon.
2005. The Impact of BDCRB
(2-Bromo-5,6-Dichloro-1-_-D-Ribofuranosyl Benzimidazole Riboside) and
Inhibitors of DNA, RNA, and Protein Synthesis on Human Cytomegalovirus
genome maturation. Journal of Virology, 79:11115-11127. Abstract
Abhijit Dighe, Marisela Rodriguez, Pearl
Sabastian, Xuefang Xie, Michael McVoy, and Michael G. Brown.
2005. Requisite H2k role in NK cell-mediated resistance in acute
murine CMV infected MA/My mice. Journal of Immunology,
175:6820-8. Abstract
Selected Meeting Abstracts
McVoy, M. and S.P. Adler. 1991. Analysis of human cytomegalovirus DNA replicative intermediates: DNA forms not predicted by the rolling circle model. Third International Cytomegalovirus Workshop, Bologna Italy Abstract
McVoy, M. and S.P. Adler. 1992. Structural analysis of latent Epstein-Barr virus DNA. Plasmid, 28:180 Abstract
McVoy, M. and S.P. Adler. 1992. Analysis of human cytomegalovirus DNA replicative intermediates II: DNA forms early in the replicative cycle. 17th International Herpesvirus Workshop, Edinburgh Scotland Abstract
McVoy, M. and S.P. Adler. 1993. Detection of circular DNA early in the replication of human cytomegalovirus. 4th International Cytomegalovirus Conference, Paris France Abstract
McVoy, M. and S.P. Adler. 1993. Evidence for a concatemeric DNA replicative intermediate of human cytomegalovirus and inversion within the concatemer. 4th International Cytomegalovirus Conference, Paris France Abstract
McVoy, M. and S.P. Adler. 1994. Guinea pig cytomegalovirus (GPCMV) genomes circularize by end-to-end ligation. 19th International Herpesvirus Workshop, Vancouver B.C. Canada Abstract
McVoy, M.A. and E.S. Mocarski. 1995. pac1 is essential for cleavage/packaging in the context of a herpesvirus genome. 20th International Herpesvirus Workshop, Groningen The Netherlands Abstract
McVoy, M.A. and E.S. Mocarski. 1996. cis sequence requirements for herpesvirus genome cleavage. 21st International Herpesvirus Workshop, DeKalb Illinois Abstract
Nixon, D.E. and M.A. McVoy. 1996. Infected and uninfected cell proteins bind specifically to distinct motifs within the murine cytomegalovirus pac1 and pac2 sequences. 21st International Herpesvirus Workshop, DeKalb Illinois Abstract
Nixon, D.E., Adler, S.P, and M.A. McVoy. 1997. An infected cell protein complex binds specifically to a murine cytomegalovirus cis DNA element essential for concatemer cleavage. 6th International CMV Workshop, Orange Beach Alabama Abstract
Nixon, D.E., Adler, S.P, and M.A. McVoy. 1997. cis sequences mediating guinea pig cytomegalovirus (gpCMV) genome cleavage. 6th International CMV Workshop, Orange Beach Alabama Abstract
McVoy, M.A. and E.S.Mocarski. 1997. Tetracycline regulation of reporter gene expression within the human cytomegalovirus genome. 22nd International Herpesvirus Workshop, San Diego California Abstract
Nixon, D.E.and M.A. McVoy. 1997. Guinea pig cytomegalovirus has two mechanisms of concatemer cleavage — one duplicates the terminal repeat, the other does not. 22nd International Herpesvirus Workshop, San Diego California Abstract
Michael A. McVoy, Daniel E. Nixon, and Jae K. Hur. 1998. The direction of herpesvirus DNA concatemer cleavage/packaging is associated with pac2 cis cleavage/packaging elements. FASEB Summer Research Conferences: Virus Assembly. Saxon's River Vermont Abstract
Carlos Berbes and Michael A. McVoy. 1998. Head-full restriction of genome cleavage/packaging in murine cytomegalovirus (MCMV): a defense against defective genomes? 23rd International Herpesvirus Workshop, York UK bstract
Daniel E. Nixon, Jae K. Hur, and Michael A. McVoy. 1998. The cleavage inhibitor BDCRB alters the equilibrium of cleavage from staggered-cut to terminal repeat duplication in both guinea pig cytomegalovirus (GPCMV) and human cytomegalovirus (HCMV). 23rd International Herpesvirus Workshop, York UK Abstract
Michael A. McVoy. 1998. Evidence that a cellular DNA polymerase is involved in cleavage of human cytomegalovirus (HCMV) genomes from replicative concatemers. 23rd International Herpesvirus Workshop, York UK Abstract
Michael A. McVoy. 1999. Evidence that human cytomegalovirus DNA cleavage involves a cellular DNA polymerase. 7th International CMV Workshop, Bristol UK Abstract
McVoy, Michael A. and Daniel E. Nixon. 2000. Dramatic effects of the maturational inhibitor BDCRB on herpesvirus genome structure and packaging. FASEB Summer Research Conferences: Virus Assembly. Saxon's River Vermont Abstract
Wang, Jian Ben, Giovanni Nigro, Michael A. McVoy, and Stuart P. Adler. 2000. High levels of serum antibody to human cytomegalovirus (HCMV) pUL89 are associated with severe primary HCMV infection during pregnancy. 25th International Herpesvirus Workshop. Portland Oregon. Abstract
Berbes, Carlos, Gabriele Hahn, and Michael A. McVoy. 2000. Rapid insertion of DNA sequences to a bacmid-cloned herpesvirus genome using Tn7-mediated transposition. 25th International Herpesvirus Workshop. Portland OregonR Abstract
Lacayo, Juan C., Mark Prichard, and Michael A. McVoy. 2000. Rapid construction of a recombinant herpesvirus using a bifunctional fusion protein expressing green flourescent protien and puromycin resistance. 25th International Herpesvirus Workshop. Portland Oregon. Abstract
Nixon, Daniel E., and Michael A. McVoy. 2000. Dramatic effects of the maturational inhibitor BDCRB on genome structure and packaging of guinea pig cytomegalovirus. 25th International Herpesvirus Workshop. Portland OR Abstract
Lacayo, Juan C., and Michael A. McVoy. 2001. MHC class I down-regulation by guinea pig cytomegalovirus. 8th International Cytomegalovirus Workshop. Monterey California. Abstract
Christine Murphy,
Daniel. E. Nixon, Melissa Mondello, and Michael A. McVoy. 2003.
Guinea Pig Cytomegaloviruses Resistant to the Maturational
Inhibitor BDCRB Exhibit Remarkable Changes in Genome Structure. 28th
International Herpesvirus Workshop. Madison Wisconsin. Abstract
Alison Kuchta and Michael A. McVoy.
2004. The occurrence of circular deletions during herpesvirus DNA
replication. 29th International Herpesvirus Workshop. Reno
Nevada. Abstract
Jian Ben Wang, Carlos Berbes, and
Michael A. McVoy. 2004. Toward a detailed definition
of cis sequences required for efficient DNA cleavage and
packaging. 29th International Herpesvirus Workshop. Reno
Nevada. Abstract
Anne Sauer, Melissa Mondello, Paula
Krosky, John Drach, and Michael McVoy. 2005.
Characterization of the novel 270-kb “Monomer-Plus” DNA species formed
during human cytomegalovirus replication in the presence of the
halogenated benzimidazole maturational inhibitors TCRB and BDCRB.
10th CMV/Betaherpesvirus Workshop. Williamsburg
Virginia. Abstract
Jian Ben Wang and Michael A. McVoy.
2005. Evidence for a novel herpesvirus-conserved cis-acting
cleavage/packaging element: pac3? 10th CMV/Betaherpesvirus
Workshop. Williamsburg Virginia. Abstract
Megan Reeves, Xiaohong Cui, Mark
Schleiss, Juan Lacayo, Alistair McGregor and Michael McVoy.
2005. Guinea pig cytomegalovirus encodes three potential MHC
class I homologs. 10th CMV/Betaherpesvirus Workshop.
Williamsburg Virginia. Abstract
Book Chapters
Analysis of human cytomegalovirus (HCMV) DNA replicative intermediates: DNA forms not predicted by the rolling circle model
Michael A. McVoy and Stuart P. Adler. In M. P. Landini (ed.), Progress in Cytomegalovirus Research. Elsevier Science Publishers, Amsterdam. 1991.
INTRODUCTION The mechanism of HCMV DNA replication has not been studied in detail but has generally been assumed to be similar to that of Herpes Simplex Virus (HSV). HSV DNA is replicated via a large primary replicative intermediate (PRI) that lacks terminal restriction fragments. The structure of this PRI has not been conclusively established; however, it is likely to be one of two possibilities: i) a head to tail concatemer generated by a rolling circle mechanism or ii) interlocked unit length circles generated by theta replication1. To determine if HCMV DNA is replicated through a similar PRI, we characterized the replicative intermediates following field inversion gel electrophoresis (FIGE).
MATERIALS AND METHODS Infection and Preparation of DNA Human MRC-5 fibroblasts were infected with strain AD169 at an moi of 0.5-1.0. Cells were washed with PBS, scraped, pelleted, re-suspended in 30ul melted 1% seaplaque agarose (FMC) in TE and cast into plugs. Plugs were incubated 48h at 50 C in 0.5ml TE 1% sarkosyl 1ug/ml proteinase K and dialyzed 3x2h with TE and stored at 4 C. Field Inversion Gel Electrophoresis FIGE was performed at 10 C using 0.5X TBE in a horizontal agarose gel electrophoresis box. DNA samples were melted at 65 C and loaded into wells using a wide bore pipet tip. Forty milliliter (8x11cm) gels were run at 80V for 20h with pulses starting at 5s, increasing to 45s and a forward to backward ratio of 3:1. One hundred milliliter (11x14cm) gels were run at 120V for 36h with pulses starting at 5s and increasing to 60s. Southern Hybridization FIGE separated DNA was transferred to Nytran (Schleicher and Schuell) by capillary blotting, UV cross-linked (0.12 J/cm2) and hybridized according to the manufacturer's instructions. Probes were random hexamer labeled (Boehringer Mannheim kit) with 32P dCTP (106 cpm/hybridization). Terminal fragment analysis DNA from cells 5 days post-infection (PI) were separated by FIGE in duplicate on a 40ml 1% seaplaque gel. One lane was cut from the gel and dialyzed 3x30min with 1X EcoRI buffer, then digested for 16h at 37 C with 2500U EcoRI. The digested gel slice was cast laterally into a 100ml 1% agarose gel and separated in a second dimension by FIGE at 120V for 20 h. Pulses increased from 0.1 to 2.0s with forward to backward ratio of 2:1. The gel was aligned with the undigested duplicate lane and overlaid with 1% agarose. The composite gel was blotted and sequentially hybridized with probes (fig.1) specific for the long arm terminal fragment W (pON227), the short arm terminal fragments N and L (Towne XbaI I in pACYC184), or a long unique region control (Towne XbaI E in pACYC184). -irradiation DNA plugs from cells 5 days PI were separated by FIGE on a 40ml gel and the positions of DNA forms were determined by ethidium bromide staining of lanes cut from each edge of the gel. DNA forms were cut into blocks, placed in microfuge tubes containing 1 ml TE, and -irradiated using a CES-I- RAD 1000 137Cs/134Cs source. Irradiated blocks were cast into a 100ml gel and separated by FIGE. Gels were blotted and probed with the Towne XbaI E fragment.
RESULTS DNA prepared five days PI contains four HCMV DNA forms: a high molecular weight (HMW) form that does not migrate from the loading well, an approximately 1000 kb form, a 500-600 kb form, and a unit-length form of 230 kb (fig.2 lane 5). DNA from uninfected cells did not hybridize with the probe. Time course DNA was prepared from cultures one hour PI and each day thereafter. DNA was separated by FIGE, Southern blotted and probed with the XbaI E fragment (fig.2). Viral DNA is first detected in the HMW form 48h PI. Unit length DNA is first detected on day 4 and the 500-600 kb and 1000 kb forms are first detected on day 5. Pulse labeling experiments using 32P phosphate confirmed that the HMW form is first synthesized at about 36-48h PI and is subsequently processed to the smaller forms (data not shown). Terminal Fragment Analysis Probing for the short arm EcoRI terminal fragments N and L with the XbaI I probe (fig.1) reveals that only unit length DNA has short arm termini (N and L are not detected in HMW, 1000 kb, and 500-600 kb DNA but are detected in unit length DNA, not shown). Reprobing for the long arm EcoRI terminal fragment W with the pON227 probe reveals that only unit length DNA has long arm termini (W is not detected in HMW, 1000 kb or 500-600 kb DNA but is detected in unit length DNA, not shown). Reprobing with a long unique region fragment (XbaI E) demonstrates that all four forms have the four EcoRI fragments that overlap with XbaI E (not shown).
-Irradiation Analysis Low dose -irradiation was used to distinguish circular from linear DNA forms (unit sized circles are converted to unit length linear molecules by a single double-stranded break; linear molecules are broken into random-length fragments2). -irradiation of 230 kb and 1000 kb DNA produced a shearing pattern consistent with linear DNA - even smearing with no discrete bands produced (not shown). -irradiation of 500-600 kb DNA produced a band of 230 kb, suggesting that 500-600 kb DNA is composed, at least in part, of unit length circles (not shown). No discrete bands of any size are produced by -irradiation of HMW DNA, indicating that it is not composed of interlocked circles (not shown).
DISCUSSION Our results indicate that the HMW DNA is the primary replicative intermediate of HCMV: it is synthesized first, is large, and lacks termini. It is not composed of interlocked circles and may be a long linear concatemer. The 500-600 kb and 1000 kb DNA forms lack termini and are therefor not products of incomplete cleavage (dimers and tetramers) of a concatemer. Such molecules should have terminal fragments albeit at reduced molar ratios. The 1000 kb form is apparently linear. Its role in the replicative process, if any, is unknown. The 500-600 kb DNA is composed in part of unit length circles and is present in low but significant amounts. Two models satisfy the current data on Herpesvirus DNA replication: (1) the rolling circle model, which is generally favored, suggests that the PRI is a long linear concatemer of head to tail linked genomes; (2) the theta replication model suggests that the PRI is composed of interlocked unit length circles1. Our observation that the HMW DNA is not composed of interlocked circles clearly rules out the theta replication model for HCMV; however, the presence of significant amounts of unit length circular DNA is not consistent with the rolling circle model. The presence of these circles suggests that replication may proceed in a process analogous to that of E. coli phage Lambda3 in which the linear genome circularizes and replicates first by theta replication producing unit length circles. Late in infection replication switches to rolling circle, using the unit length circles produced by early theta replication as templates.
Packaging DNA into Herpesvirus Capsids
Jay C. Brown, Michael A. McVoy and Fred L. Homa. In A. Holzenburg and E. Bogner (ed.), Structure-Function Relationships of Human Pathogenic Viruses. Kluwer Academic/Plenum Publishers, London. 2002.
Injection of DNA into a pre-formed capsid is a central event in
herpesvirus replication.
Similar packaging of DNA into a pre-formed shell is also observed
during
replication of dsDNA bacteriophage such as T4 and l; adenoviruses may
encapsidate
DNA in the same way. Herpesvirus DNA packaging takes place in the
infected cell nucleus where capsid assembly and DNA replication also
occur.
The substrates for packaging are capsids plus the multi-genome,
concatemeric DNA that is the product of virus DNA replication.
During the encapsidation process, double strand cuts are made at
specific sites (pac sites) in
the DNA concatemer so that one complete genome is packaged into each
capsid.
Genetic studies with herpes simplex
virus 1 (HSV-1) have resulted in identification of seven virus genes
whose protein products are specifically involved in DNA
encapsidation. None is required, for example, for capsid
formation or DNA replication. The seven proteins are expected to
be involved in processes such as introduction of specific cuts in the
DNA concatemer, formation of a portal through which virus DNA can enter
the capsid, provision of the energy required for DNA translocation into
the capsid and sealing the capsid once it is filled.
Investigators are studying herpesvirus DNA packaging with the idea that
it constitutes an attractive target for novel therapeutic agents
directed against herpesvirus replication. Encapsidation is
particularly appealing as a target
because it is required for herpesvirus growth, and because most, if not
all, of the proteins involved are virus-encoded.
Recent
studies of herpesvirus DNA packaging have defined the basic nature of
the process and provided information about the components involved in
individual steps. Here we summarize recent progress with emphasis
on areas such as pac site recognition and the function of the
processing/packaging proteins where there has been the most
interest. Discussion is focused on HSV-1 with other
herpesviruses, particularly cytomegalovirus, mentioned when relevant
studies have been done. The mechanism of DNA encapsidation as it
occurs in dsDNA bacteriophage is described briefly because the same
basic mechanism is expected to apply in herpesviruses and because, as
studies with phage are generally more advanced, they have suggested
productive lines of research with herpesviruses. We conclude with
a brief description of small molecule packaging inhibitors that have
the potential to be developed as anti-herpes therapeutics.
Réplication,
clivage-encapsidation et recombinaison de I’ADN des herpèsvirus
Schynts, F., F. Meurens,
B. Muylkens, A. L. Epstein, M. McVoy, and E. Thiry. Virologie, in
press.
*Herpesvirus genomes consist of a large, linear double stranded
DNA. The DNA replication process of herpesviruses takes place in
the nucleus where the genome circularizes and is replicated by a
mechanism resulting in formation of concatemeric molecules
in which the genomic termini are fused in a head-to-tail
arrangement. This process requires the expression of virally
encoded proteins. Concatemers
are then cleaved at specific sites by viral proteins, specified by the
presence of cis-acting sequences, to form unit-length molecules that
are packaged
into newly formed capsids. This paper summarizes the current
knowledge
of both replication and cleavage/packaging of herpesvirus DNA as well
as
antiviral drugs which target these viral processes. Finally,
herpesvirus
DNA recombination is described because it is intimately linked to the
DNA
replication process.
*note: This paper is in
French. The abstract above has been translated to English.
Selected Journal Publications
Human cytomegalovirus DNA replicates after early circularization by concatemer formation and inversion occurs within the concatemer
Michael A. McVoy and Stuart P. Adler. 1994. Journal of Virology, 68:1040-1051.
To determine the replicative mechanism for human cytomegalovirus (HCMV) DNA, field- inversion gel electrophoresis was used to separate HCMV replicative DNAs during lytic infection. Unit length circular HCMV genomes lacking terminal restriction fragments were detected starting four hours after infection even when cells were treated with aphidicolin, phosphonoacetic acid, or cycloheximide. Viral DNA synthesis began 24 hours after infection and produced large amounts of high molecular weight replicative DNA that was a precursor of progeny genomes. Replicative DNA contained rare terminal restriction fragments and long arm termini were much less frequent than short arm termini. Replicative DNA was not composed of unit length circles because low dose -irradiation of replicative DNA generated numerous random high molecular weight fragments rather than unit length molecules. PacI digestion of replicative DNA from a recombinant HCMV with two closely spaced PacI sites revealed that replicative DNA is concatemeric and genome segment inversion occurs after concatemer synthesis. These results show that after circularization of the parental genome, DNA synthesis produces concatemers by a rolling circle mechanism and genomic inversion occurs within concatemeric DNA. The results further suggest that concatemers acquire genomic termini during the cleavage/packaging process which preferentially inserts short arm termini into empty capsids causing a predominance of short arm termini on the concatemer.
Circularization and cleavage of guinea pig cytomegalovirus genomes
Michael A. McVoy, Daniel E. Nixon, and Stuart P. Adler. 1997. Journal of Virology,71:4209-4217.
The mechanisms by which herpesvirus genome ends are fused to form circles after infection and are re-formed by cleavage from concatemeric DNA are unknown. We used the simple structure of guinea pig cytomegalovirus genomes, which have either one repeated DNA sequence at each end or one repeat at one end and no repeat at the other, to study these mechanisms. In circular DNA, two restriction fragments contained fused terminal sequences and had sizes consistent with the presence of single or double terminal repeats. This result implies a simple ligation of genomic ends and shows that circularization does not occur by annealing of single stranded terminal repeats formed by exonuclease digestion. Cleavage to form the two genome types occurred at two sites and homologies between these sites identified two potential cis elements that may be necessary for cleavage. One element coincided with the A rich region of a pac2 sequence and had 9 of 11 bases identical between the two sites. The second element had 6 bases identical at both sites, in each case 7 bp from the termini. To confirm the presence of ciscleavage elements, a recombinant virus was constructed in which foreign sequences displaced the 6 and 11 bp elements 1 kb from the cleavage point. Cleavage at the disrupted site did not occur. In a second recombinant virus, restoration of 64 bases containing the 6 and 11 bp elements to the disrupted cleavage site restored cleavage. Therefore, cis cleavage elements exist within this 64 base region and sequence conservation suggests that they are the 6 and 11 bp elements.
Sequences within the Herpesvirus-conserved pac1 and pac2 Motifs are Required for Cleavage and Packaging of the Murine Cytomegalovirus Genome
Michael A. McVoy, Daniel E. Nixon, Stuart P. Adler, and Edward S. Mocarski. Journal of Virology, 72:48-56
The DNA sequence motifs pac1 (an A-rich region flanked by poly(C) runs) and pac2 (CGCGGCG near an A-rich region) are conserved near herpesvirus genomic termini and are believed to mediate cleavage of genomes from replicative concatemers. To determine their importance in the cleavage process, we constructed a number of recombinant murine cytomegaloviruses with a second cleavage site inserted at an ectopic location within the viral genome. Cleavage at a wild type ectopic site occurred as frequently as at the natural cleavage site, whereas mutation of this ectopic site revealed that some of the conserved motifs of pac1 and pac2 were essential for cleavage while others were not. Within pac1, the left poly(C) region was very important for cleavage and packaging but the A-rich region was not. Within pac2, the A- rich region and adjacent sequences were essential for cleavage and packaging and the CGCGGCG region contributed to, but was not strictly essential for, efficient cleavage and packaging. A second A-rich region was not important at all. Duplication and deletion of the murine cytomegalovirus 30 bp terminal repeat was found to be contingent on cleavage. Plasmids used for virus construction contained either one or two copies of the 30 bp terminal repeat, whereas viral genomes with cleavage competent ectopic sites contained a mixture of single and double repeats. Sites with mutations that prevented cleavage retained the characteristic number of 30 bp repeats found in the plasmids used for their construction. Given that the processes of genome cleavage and packaging appear to be highly conserved among herpesviruses, these findings should be relevant to other members of this family.
Tetracycline regulation of reporter gene expression within the human cytomegalovirus genome
Michael A. McVoy and Edward S. Mocarski. Virology 258:295-303
Conditional control of gene
expression using an exogenous agent such as the antibiotic tetracycline
has the potential to impact the study of gene functions encoded by
large viral genomes.
Expression of the luciferase gene luc under the control of derivatives
of the tetracycline-regulatable promoter PhCMV*-1 was studied in
uninfected and human cytomegalovirus-infected human fibroblast cells
stably expressing tTA, a chimeric regulatory protein that activates by
binding to tet operator sites (Gossen, M., and H. Bujard. 1992. Proc
Natl Acad Sci USA 89:5547-51).
In uninfected fibroblasts, tetracycline mediated a 15- to 20-fold
change
in luciferase levels; however, viral infection alone activated
expression
of PhCMV*-1 several hundred-fold. In an effort to derive
promoters
with greater differential regulation by tetracycline in virus-infected
cells, PhCMV*-1 was modified to create additional promoter
constructs. Two were characterized in detail by transient assay
and introduction into the viral genome: P1125 contains seven tTA
binding sites upstream of promoter sequences from the adenovirus major
late promoter and an initiator from terminal
deoxynucleotidyltransferase and exhibited a higher degree of
tetracycline control as well as a high level of activation by viral
infection; P1129 contains a single tTA binding site in the context of
the human cytomegalovirus ie1/ie2 promoter and exhibited reduced
activation by viral infection and
poor differential regulation. In the context of the viral genome,
P1125
displayed nearly 100-fold regulation by tetracycline during late times
of
infection, whereas PhCMV*-1 and P1129 exhibited regulation of only two-
to
eight-fold. Significant luciferase expression and six-fold levels
of
differential tetracycline regulation were observed for P1125 during
early
times of infection. The effects of adding or removing
tetracycline
were fully reversed within 12 to 24 h. These results suggest that
the
P1125 promoter may provide sufficient conditional expression to
effectively
regulate human cytomegalovirus early or late genes.
The ends on herpesvirus DNA replicative concatemers contain pac2 cis cleavage/packaging elements and their formation is controlled by terminal cis sequences
Michael A. McVoy, Daniel E. Nixon, Jay K. Hur, and Stuart P. Adler. Journal of Virology, 74:1587-1592.
Herpesviruses have large double-stranded linear DNA genomes that are formed by site-specific cleavage from complex concatemeric intermediates. In this process only one of the two genomic ends are formed on the concatemer. Although the mechanism underlying this asymmetry is not known, one explanation is that single genomes are cleaved off of concatemer ends in a preferred direction. This implies that cis elements control the direction of packaging. Two highly conserved cis elements named pac1 and pac2 lie near opposite ends of herpesvirus genomes and are important for cleavage and packaging. By comparison of published reports and by analysis of two additional herpesviruses, we found that pac2 elements lie near the ends formed on replicative concatemers of four herpesviruses: herpes simplex virus type 1, equine herpesvirus type 1, guinea pig cytomegalovirus, and murine cytomegalovirus. Formation of pac2 ends on concatemers depended on terminal cis sequences, since ectopic cleavage sites engineered into the murine cytomegalovirus genome mediated formation of pac2 ends on concatemers regardless of the orientation of their insertion. These findings are consistent with a model in which pac2 elements at concatemer ends impart a directionality to concatemer packaging by binding proteins that initiate insertion of concatemer ends into empty capsids.
The machinery to support genome segment inversion exists
in a herpesvirus which does not naturally
contain invertible elements
Michael A. McVoy and D. Ramnarain. Journal of Virology, 74:4882-7
In many herpesviruses genome segments flanked by inverted repeats invert during DNA replication. It is not known whether this inversion is a consequence of an inherently recombinagenic replicative mechanism common to all herpesviruses, or whether the replication enzymes of viruses with invertible segments have specifically evolved additional enzymatic activities to drive inversion. By artificially inserting a fusion of terminal sequences into the genome of a virus which normally lacks invertible elements (murine cytomegalovirus), we created a genome comprised of long and short segments flanked by 1,359- and 543-bp inverted repeats. Analysis of genomic DNA from this virus revealed that inversion of both segments generates equimolar amounts of four isomers during the viral propagation necessary to produce DNA for analysis from a single viral particle. We conclude that a herpesvirus which naturally lacks invertible elements is able to support efficient segment inversion. Thus, the potential to invert is probably inherent in the replication machinery of all herpesviruses, irrespective of genome structure, and therefore, genomes with invertible elements could have evolved simply by acquisition of inverted repeats and without concomitant evolution of enzymatic activities to mediate inversion. Furthermore, the recombinagenisity of herpesviral DNA replication must have some importance independent of genome segment inversion.
A bifunctional protein conferring enhanced green fluorescence
and puromycin resistance
Jessica Abbate, Juan C. Lacayo, Mark Prichard, Gregory Pari, and Michael A. McVoy. BioTechniques 31: 340-347.
A new genetic marker was created in which sequences from enhanced green fluorescent protein were fused to those of puromycin N-acetyl transferase. The resulting fusion protein (EGFP-puro) conferred both green fluorescence and resistance to puromycin when expressed in mammalian cells. The utility of EGFP-puro as a selectable/screenable marker was demonstrated by the ease in which a recombinant guinea pig cytomegalovirus containing EGFP-puro was isolated by a combination of puromycin selection and screening for green fluorescence. We conclude that EGFP-puro is a compact and versatile marker that should prove useful for recombinant virus and transgenic cell line construction, particularly in applications where coding capacity is limited.
Terminally repeated sequences on a herpesvirus genome are deleted following circularization but are reconstituted by duplication during cleavage and packaging of concatemeric DNA
Daniel E. Nixon and Michael A. McVoy. Journal of Virology, 76:2009-2013.
The mechanisms underlying cleavage of herpesvirus genomes from replicative concatemers are unknown. Evidence from herpes simplex virus type 1 suggests that cleavage occurs by a nonduplicative process; however, additional evidence suggests that terminal repeats may also be duplicated during the cleavage process. This issue has been difficult to resolve due to the variable numbers of reiterated terminal repeats that the herpes simplex virus type 1 genome can contain. Guinea pig cytomegalovirus is a herpesvirus with a simple terminal repeat arrangement that defines two genome types. Type II genomes have a single copy of a 1-kb terminal repeat at both their left and right termini, whereas type I genomes have only one copy at their left termini and lack the repeat at their right termini. In a previous study, we constructed a recombinant guinea pig cytomegalovirus in which certain cis elements were disrupted such that only type II genomes were produced. Here, we show that double repeats that are formed by circularization of infecting genomes are rapidly converted to single repeats, such that the junctions between genomes within replicative concatemers formed late in infection almost exclusively contain single copies of the terminal repeat. Therefore, for the recombinant virus, each cleavage event begins with a single repeat within a concatemer yet produces two repeats, one at each of the resulting termini, demonstrating that terminal repeat duplication occurs in conjunction with cleavage. For wild type guinea pig cytomegalovirus, the formation of type I genomes further suggests that cleavage can also occur by a nonduplicative process and that duplicative and nonduplicative cleavage can occur concurrently. Other herpesviruses having terminal repeats, such as the herpes simplex viruses and human cytomegalovirus, may also utilize repeat duplication and deletion; however, the biological importance of these events remains unknown.
Kinetics of Expression of Rhesus Monkey Rhadinovirus (RRV) and Identification and Characterization of a Polycistronic Transcript Encoding the RRV Orf50/Rta, RRV R8, and R8.1 Genes
Scott M. DeWire, Michael A. McVoy, and Blossom Damania. Journal of Virology, 76:9819-9831.
Rhesus monkey rhadinovirus (RRV) is a close relative of Kaposi’s
sarcoma-associated herpesvirus (KSHV; human herpesvirus 8). RRV
serves as an in vitro and an in vivo model for KSHV, and the mapping of
its transcription program during lytic replication is significant since
it represents de novo infection in the absence of stimulation with
phorbol esters. Further, the RRV lytic system facilitates the
making of recombinant viruses, and hence transcription profiling of the
wild-type virus is important. Currently, the kinetics of lytic
gene expression of RRV, the function of the RRV Orf50/Rta gene, and the
presence of the RRV R8 and R8.1 genes are not known. This study
details the transcription profile seen during RRV lytic replication and
shows that RRV latency-associated nuclear antigen, viral FLIP (vFLIP),
and
vCyclin are transcribed during the RRV lytic phase. In addition,
this
study describes the identification of three new spliced products of the
RRV Orf50, R8, and R8.1 genes, which are structural homologs of the
KSHV
Orf50, K8, and K8.1 genes, respectively. Characterization of the
RRV
Orf50 protein identifies it as a strong transcriptional transactivator
capable
of activating three early RRV promoters. Interestingly, the KSHV
Orf50
transactivator can also activate these simian virus promoters,
suggesting
that there exists a conservation of gene function between the key
transcription
factors of KSHV and RRV.
Tn7-mediated introduction of DNA sequences
into bacmid-cloned cytomegalovirus genomes for rapid recombinant virus
construction
Gabriele Hahn, Margit
Jarosch, Jian Ben Wang, Carlos Berbes, and Michael A. McVoy.
Journal of Virological Methods, 107:185-194.
Our basic understanding of how viruses
infect, replicate, and cause disease has been largely derived from
genetic approaches in which viral sequences have been mutated and the
consequences of those mutations determined. In the herpesvirus
field, deletions or insertions that preclude expression of specific
viral proteins or remove critical cis elements have been invaluable in
identifying their overall
functions. We are now ready to move to a new level of detail -
mapping
functional domains within viral proteins or defining cis elements to
the
nucleotide level. This level of detail will require mutagenesis
on
a new scale, with recombinant viruses containing mutations within a
given
locus perhaps numbering in the hundreds. Mutagenesis on this
scale
would be greatly facilitated by more rapid methods of recombinant virus
construction. In this report, we adapted a technology employing
Tn7-mediated
site-specific transposition (Lukow et al. 1993. J. Virol. 67:4566-79)
as
a rapid and highly reliable method to introduce novel sequences into
bacmid-cloned
herpesvirus genomes. We show that recombinant viruses can be
rapidly
created and that a deletion of the human cytomegalovirus essential gene
ie2 can be complemented in cis by reintroduction, via transposition, of
an ie2 cDNA; detailed mutagenesis of the complementing ie2 gene can now
follow. Tn7-mediated transposition should greatly accelerate the
pace at which recombinant herpesviruses can be constructed and thus
facilitate
the use of recombinant viruses for detailed mutagenic studies of both
cis-
and trans-acting genetic elements.
Dramatic
effects of BDCRB (2-bromo-5,6-Dichloro-1-b-D-ribofuranosyl
benzimidazole riboside) on the Genome Structure, Packaging, and Egress
of Guinea Pig Cytomegalovirus
Daniel E.
Nixon1 and Michael A. McVoy. Journal of Virology, 78:1623-1635.
The
halogenated benzimidazoles BDCRB and TCRB were the first compounds
shown to inhibit cleavage and packaging of herpesvirus genomes.
Both inhibit the formation of unit length human cytomegalovirus (HCMV)
genomes by a poorly understood mechanism (Underwood et al. J. Virol.,
1998, 72, 717-715; Krosky et al. J. Virol.. 1998, 72, 4721-4728).
Because the simple genome structure of guinea pig cytomegalovirus
(GPCMV) provides a useful model for the study of herpesvirus DNA
packaging, we investigated the effects of BDCRB on GPCMV. GPCMV
proved to be sensitive to BDCRB (IC50=4.7 mM), although somewhat less
so than HCMV. In striking contrast to HCMV, however, a dose of
BDCRB sufficient to reduce GPCMV titers by 3 logs (50 mM) had no effect
on the quantity of GPCMV genomic DNA that was formed in infected
cells. Electron microscopy revealed that this DNA was in fact
packaged within intranuclear capsids, but these capsids failed to
egress from the nucleus and failed to protect the DNA from nuclease
digestion. The terminal structure of genomes formed in the
presence of BDCRB was also altered. Genomes with ends lacking a
terminal repeat at the right end, which normally exist in an equimolar
ratio with those having one copy of the repeat at the right end, were
selectively eliminated by BDCRB treatment. At the left end, BDCRB
treatment induced heterogeneous truncations such that 2.7- to 4.9-kb of
left-end terminal sequences were missing. These findings suggest
that BDCRB induces premature cleavage events that result in truncated
genomes packaged within capsids that are permeable to nuclease.
Based on these and other observations, we propose a model for
duplication of herpesvirus terminal repeats during the
cleavage/packaging process that is similar to one proposed for
bacteriophage T7 (Chung et al. J. Mol. Biol., 1990, 216, 939-948).
The Nonnucleoside Antiviral, BAY 38-4766,
Protects Against Cytomegalovirus Disease and Mortality in
Immunocompromised Guinea Pigs
Mark
R. Schleiss, David I. Bernstein, Michael A. McVoy, Greg Stroup,
Fernando Bravo, Blaine Creasy, Alistair McGregor, Kristin Henninger,
and Sabine Hallenberger. 2005. Antiviral Research,
65:35-43.
New antiviral drugs are needed for the treatment of cytomegalovirus
(CMV) infections, particularly in immunocompromised patients.
These studies evaluated the in vitro and in vivo activity of the
nonnucleosidic CMV inhibitor, BAY 38-4766, against guinea pig
cytomegalovirus (GPCMV). Plaque reduction assays indicated that
BAY 38-4766 was active against GPCMV, with an IC50 of 0.5 microM. Yield reduction
assays demonstrated an ED90 and ED99 of 0.4 and 0.6 microM, respectively, of BAY
38-4766 against GPCMV. Guinea pigs tolerated oral administration of 50
mg/kg/day of BAY 38-4766 without evidence of biochemical or hematologic
toxicity. Plasma concentrations of BAY 38-4766 were high
following oral dosing, with a mean peak level at 1 hour post-dose of
26.7 _g/ml (n=6; range, 17.8-35.4). Treatment with BAY 38-4766
reduced both viremia and DNAemia following GPCMV infection of
cyclophosphamide-immunosuppressed strain 2 guinea pigs (p<0.05,
Mann-Whitney test). BAY 38-4766 also dramatically reduced
mortality following lethal GPCMV challenge in immunosuppressed, outbred
Hartley guinea pigs, from a level of 83% (20/24) in placebo-treated
guinea pigs, to 17% (4/24) in BAY 38-4766 treated animals (p<0.001,
Fisher’s exact test). These mortality differences were
accompanied by reduction in systemic DNAemia at late time points
post-infection. Based upon its favorable safety,
pharmacokinetic, and therapeutic profiles, BAY 38-4766 warrants further
investigation in the GPCMV model.
The Impact of
BDCRB (2-Bromo-5,6-Dichloro-1-b-D-Ribofuranosyl
Benzimidazole Riboside) and Inhibitors of DNA, RNA, and Protein
Synthesis on Human Cytomegalovirus genome maturation
Michael A. McVoy and Daniel E. Nixon. 2005. Journal of Virology, 79:11115-11127
Herpesvirus genome maturation is
a complex process in which concatemeric DNA molecules are translocated
into capsids and cleaved at specific sequences to produce encapsidated
unit genomes. Bacteriophage studies further suggest that
important ancillary processes such as RNA transcription or DNA
synthesis concerned with repeat duplication, recombination, branch
resolution, or damage repair may also be involved with the genome
maturation process. To gain insight into the biochemical
activities needed for herpesvirus genome maturation, BDCRB was used to
allow accumulation of human cytomegalovirus concatemeric DNA while
blocking formation of new genomes. Genome formation was restored
upon BDCRB removal and addition of various inhibitors during this time
window permitted evaluation of their effects on genome
maturation. Inhibitors of protein synthesis, RNA transcription,
and the viral DNA polymerase only modestly reduced genome formation,
demonstrating that these activities are not required for genome
maturation. In contrast, drugs that inhibit both viral and host
DNA polymerases potently blocked genome formation. Radioisotope
incorporation in the presence of a viral DNA polymerase inhibitor
further suggested that significant host-mediated DNA synthesis occurs
throughout the viral genome. These results indicate a role for
host DNA polymerases in genome maturation and are consistent with a
need for terminal repeat duplication, debranching, or damage repair
concomitant with DNA packaging or cleavage. Similarities to
previously reported effects of BDCRB on guinea pig cytomegalovirus were
also noted; however, BDCRB induced low-level formation of a
supergenomic species called monomer+ DNA that is unique to human
cytomegalovirus. Analysis of monomer+ DNA suggested a model for
its formation in which BDCRB permits limited packaging of concatemeric
DNA but induces skipping of cleavage sites.
Requisite H2k role in NK cell-mediated
resistance in acute murine CMV infected MA/My mice
Abhijit Dighe, Marisela Rodriguez, Pearl Sabastian, Xuefang Xie,
Michael McVoy, and Michael G. Brown. 2005. Journal of
Immunology, 175:6820-8
Human CMV infections are a major health risk in patients with dysfunctional or compromised immunity, especially in patients with NK cell deficiencies, as these are frequently associated with high morbidity and mortality. In experimental murine CMV (MCMV) infections, Ly49H activation receptors on C57BL/6 (B6) NK cells engage m157 viral ligands on MCMV-infected cells and initiate dominant virus control. In this study, we report that MCMV resistance in MA/My relies on Ly49H-independent NK cell-mediated control of MCMV infection as NK cells in these mice do not bind anti-Ly49H mAb or soluble m157 viral ligands. We genetically compared MA/My resistance with MCMV susceptibility in genealogically and NK gene complex-Ly49 haplotype-related C57L mice. We found that MCMV resistance strongly associated with polymorphic H2(k)-linked genes, including MHC and non-MHC locations by analysis of backcross and intercross progeny. The H2(b) haplotype most frequently, but not absolutely, correlated with MCMV susceptibility, thus confirming a role for non-MHC genes in MCMV control. We also demonstrate a definite role for NK cells in H2(k)-type MCMV resistance because their removal from C57L.M-H2(k) mice before MCMV infection diminished immunity. NK gene complex-linked polymorphisms, however, did not significantly influence MCMV control. Taken together, effective NK cell-mediated MCMV control in this genetic system required polymorphic H2(k) genes without need of Ly49H-m157 interactions.
Meeting abstracts
Analysis of human cytomegalovirus (HCMV) DNA replicative intermediates: DNA forms not predicted by the rolling circle model
Michael A. McVoy and Stuart P.
Adler.
Third International Cytomegalovirus
Workshop, Bologna, Italy, 1991
Little is known about the structural intermediates of HCMV replication. The rolling circle model predicts a long linear concatemer, however, an intermediate of interlocked unit length circles resulting from a theta replicative mechanism would also have a high apparent molecular weight and lack terminal nts. We used field inversion gel electrophoresis (FIDE) separation of infected cell DNA o study the intermediates of HCMV replication. Southern hybridization of FIDE separated DNA from 5 day infected fibroblasts revealed four forms of HCMV DNA with apparent molecular weights of 230 kb, 500-600 kb, 1.1-1.6 Mb, and a high molecular weight form (>1.9 Mb). A pulse labeling time course revealed that the high molecular weight (HMW) form becomes labeled first, at 31-48 hours, and can be chased into the smaller forms. Terminal restriction fragment analysis revealed that only the 230 kb form contains long and short arm terminal fragments. Low dose gamma irradiation was used to differentiate circular from linear DNA forms (unit sized circles are converted to unit length linear molecules by a single double stranded break; linear molecules are broken into random length fragments). The four forms of viral DNA were first separated by FIGE and cut from the gel in agarose plugs. Following gamma irradiation of the agarose plugs at various doses, the DNA was analyzed by FIGE. Gamma irradiation converted the 500-600 kb DNA to 230 kb, indicating that it is composed of 230 kb (unit length) circles; however, gamma irradiation did not convert 1.1-1.6 Mb DNA to 230 kb, indicating this form was initially linear. Gamma irradiation of HMW DNA did not result in the release of unit length molecules; therefore, the HMW DNA is not composed of interlocked circles and is likely to be the long linear concatemer predicted by the rolling circle model. However, the significant amounts of unit length circles and 1.1-1.6 Mb linear molecules lacking terminal fragments cannot be explained by the rolling circle model and indicae that HCMV replication has additional complexity.
Structural analysis of latent Epstein-Barr virus (EBV) DNA.
M.A. McVoy and S.P. Adler. Plasmid, 28:180.1992.
During latent infection of human B cells, the EBV genome is believed to exist as a 170 kb circular molecule. We investigated the structure of latent EBV DNA in the Raji cell line utilizing g-radiation induced DNA cleavage and field-inversion gel-electrophoresis (FIGE). DNA prepared from Raji cells was separated by FIGE. EBV DNA was detected by hybridization with the cloned EBV BamHI W fragment. EBV DNA did not migrate from the wells of the FIGE gel, suggesting that the EBV DNA circles are be interlocked with other EBV genomes or with cellular DNA. If latent EBV DNA is composed of interlocked circles, a low dose of g-radiation should cleave some circles only once, releasing unit length (170 kb) linear DNA from the interlocked form. Raji cell DNA was exposed to increasing amounts of g-radiation, separated by FIGE, and hybridized as before. EBV DNA which remained in the well in the absence of g-radiation was converted by g-irradiation to a form that migrated with a molecular weight of approximately 170 kb. These results provide strong physical evidence that latent EBV genomes are circular and further indicate that they are interlocked, either with other EBV genomes or with chromosomal DNA.
Analysis of human cytomegalovirus (HCMV) DNA replicative intermediates II: DNA forms early in the replicative cycle
M.A. McVoy and S.P. Adler.
17th International Herpesvirus
Workshop, Edinburgh, Scotland, 1992.
We have previously described four HCMV (AD169) DNA forms, separable by field- inversion gel electrophoresis (FIGE), 5 days after infection of permissive human fibroblast cells: (i) a "230 kb" unit length linear DNA; (ii) a "500 kb" DNA, probably composed in part of 230 kb circles because it converts to 230 kb linear DNA spontaneously and upon g-irradiation; (iii) a "1 Mb" apparently linear DNA; and (iv) a "Late High Molecular Weight (HMW)" DNA that fails to migrate from the sample well, lacks terminal restriction fragments, but is not composed of unit length circles. We now report our analysis of the HCMV DNA forms found early in the replicative cycle. At 3 h post infection (PI), HCMV DNA was predominantly unit length linear and non-encapsidated (230 kb, normal terminal restriction fragments, nuclease sensitive). By 24 h PI, HCMV DNA appeared in a form that failed to migrate from the sample well. Infection with 32P labeled virions showed that input virion DNA is "converted" to this "Early HMW" form starting at 6 h PI. Early HMW DNA lacked terminal restriction fragments. Low dose g-irradiation of Early HMW DNA resulted in a high molecular weight smear, indicating that it is not composed of circular molecules and may be concatemeric. Production of Early HMW DNA was not inhibited by phosphonoacetic acid (PAA), cycloheximide, or aphidocolin. In contrast, synthesis by viral DNA polymerase, producing Late HMW DNA, was apparent by 48 h and was inhibited by both cycloheximide and PAA, but not aphidocolin. 500 kb and 1 Mb DNA were not detected prior to 72 h PI. We detected no stable HCMV DNA circles early in infection, indicating a lack of early replication. The conversion of input DNA to Early HMW DNA involves loss of termini and possible concatemerization but does not require protein synthesis of viral or host factors, host DNA polymerase (aphidocolin sensitive), or viral DNA polymerase (PAA sensitive). We were not able to structurally distinguish Early HMW from Late HMW DNA: both lacked termini, failed to migrate into FIGE gels, and smeared following g-irradiation.
Detection of circular DNA early in the replication of human cytomegalovirus (HCMV)
Michael A. McVoy and Stuart P.
Adler.
4th International Cytomegalovirus
Conference, Paris France, 1993.
We have previously found that, by 24 hours after infection, linear 230 kb viral DNA is converted to a high molecular weight form (Early HMW DNA) that does not migrate from the sample well of a field-inversion gel, and that formation of Early HMW DNA is not inhibited by cycloheximide, phosphonoacetic acid, or 5 µg/ml aphidicolin. Furthermore, g-irradiation failed to reveal evidence for circular forms. We now report that when Tris/EDTA buffer is used to wash cells prior to DNA preparation, g-irradiation of Early HMW DNA results in a dose responsive release of 230 kb DNA (indicating the presence of unit circular forms early in infection), and high molecular weight smearing (suggestive of long linear forms). In addition, 10 µg/ml aphidicolin inhibited the formation of Early HMW DNA. These results indicate that Early HMW DNA is a mixture of circular and concatemeric forms synthesized by host DNA polymerases (aphidicolin sensitive, phosphonoacetic acid insensitive). We propose that HCMV DNA circularizes shortly after infection and undergoes early rolling circle replication mediated by host DNA polymerases, which are latter replaced by viral DNA polymerase.
Evidence for a concatemeric DNA replicative intermediate (RI) of human cytomegalovirus (HCMV) and inverstion within the concatemer
Michael A. McVoy and Stuart P.
Adler.
4th International Cytomegalovirus
Conference, Paris, France, 1993.
If the herpesvirus RI is a head-to-tail linked concatemer produced by rolling circle replication, it is not known whether inversion occurs before or after formation of the concatemer. To answer these questions, we constructed a recombinant HCMV virus, MTO-1, containing two closely spaced novel PacI restriction sites, then isolated RI DNA by field-inversion gel electrophoresis (FIGE), digested the RI DNA with PacI, and separated the resulting fragments again by FIGE. The major species was the expected 230 kb fragment resulting from cleavage of the RI into unit length molecules. A 370 kb fragment, predicted if inversion results in different long arm isomers adjacent within a concatemer, was present in less than equimolar amounts. Because rolling circle replication of a unit circular template should result in homogeneous concatemers, all genome copies within a given concatemer should be the same isomeric form as the template. The presence of the 370 kb PacI fragment indicates that replicative DNA is heterogeneous, in that some genome copies have undergone inversion of the long arm. We conclude that the HCMV RI is concatemeric, to the extent that DNA molecules greater than unit length (370 kb) can be detected, and that inversion can occur during or after rolling circle replication.
Guinea pig cytomegalovirus (GPCMV) genomes circularize by end-to-end ligation
Michael A. McVoy and Stuart P.
Adler.
19th International Herpesvirus
Workshop, Vancouver B.C., Canada, 1994.
The GPCMV genome has either single 1kb repeats at each terminus or a single repeat at one terminus and no repeat at the other. Genome circularization by annealing of complementary single stranded termini created by exonuclease digestion of terminal repeats predicts only single repeat copies in circular DNA; circularization by annealing and ligation of single base pair complementary overhangs predicts tandem repeat copies. We used pulsed-field electrophoresis to separate circular from linear DNA in cells infected with GPCMV in the presence of DNA synthesis inhibitors. After separation, terminal and junction restriction fragments were detected by hybridization. Two junction fragments were detected in circular DNA. The molecular weight of the smaller fragment was consistent with the presence of a single repeat and that of the larger fragment was consistent with tandem repeats. Neither junction fragment was detected in DNA prepared from the inoculum. Detection of the fragment containing tandem repeats excludes exonuclease digestion and supports end-to-end ligation as the mechanism of circularization. Therefore, the fragment containing a single repeat arises from circularization of genomes lacking a terminal repeat. This further implies that cleavage can occur at single repeats, resulting in functional genomes which lack a repeat at one terminus.
pac1 is essential for cleavage/packaging in the context of a herpesvirus genome
Michael A. McVoy and Edward
Mocarski.
20th International Herpesvirus
Workshop, Gronigen, Netherlands, 1995.
cis-acting sequences pac1 and pac2 at the termini of herpesvirus genomes have been implicated in genome cleavage and packaging from concatameric replicative DNA intermediates. Although deletions of the pac1 and pac2 from the herpes simplex virus (HSV) a sequence abrogate cleavage, mutations specifically targeting the conserved motifs of pac1 and pac2 have not been tested. We constructed a recombinant murine cytomegalovirus (mCMV) containting an ectopic cleavage site to enable the selective disruption of pac1 and pac2. This created a second "cleavage frame" in concatameric DNA. A 1.9 kB fragment, derived from replicative DNA and containing fused termini, was placed beside an expression cassette for the E.coli gpt gene. These sequences were inserted into the viral genome at the site between the Hind III fragments L and J. Recombinant viruses were constructed by transfection of plasmid DNA followed by superinfection and three rounds of selection for gpt expression with mycophenolic acid and xanthine. Viruses were purified by limiting dilution and screened by Southern hybridization with a proble flanking the insertion site. All viral isolates carrying the insertion had equimolar amounts of the 7.6 kbp and 5.6/2.0 kbp BamHI restriction fragments that contained the insertion, indicating that cleavage occurred in the added site with efficiency equal to that of the natural cleavage/packaging site. Cleavage was observed whether the inserted fused termini had one or two copies of a 30 bp motif (GGGGGGCCCGCGCGCACTCAGACGGCCGGG) normally located at the mature genome termini. A mutation introduced into pac1, containing an ectopic cleavage site that failed to be recognized by the cleavage/packaging machinery. These studies demonstrate that the 1.9 kb fragment containing fused termini carries all the signals necessary for efficient cleavage and packaging, and that the pac1 A rich motif plays an essential role in this process. Analysis of mutations within the 30 bp repeat as well as within pac2 are under construction and will be presented.
cis sequence requirements for herpesvirus genome cleavage
Michael McVoy and Edward Mocarski.
21st International Herpesvirus
Workshop, DeKalb Illinois, 1996.
Two conserved sequence motifs, pac1 and pac2, are found at herpesvirus genomic termini. The murine cytomegalovirus (mCMV) pac1 consists of the sequence CCCCCCCATAAAATACCCCCCC. pac2 consists of CGCGGCG separated from an A rich region by 43 non-conserved bases. The proximity of pac1 and pac2 to the genomic termini (30-35 bp) suggest they may function in cleavage of progeny genomes from replicative concatemers. We inserted a second "ectopic" cleavage site into the mCMV genome and found that it was cleaved efficiently. To ascertain whether pac1 or pac2 are essential for cleavage, we introduced mutations to the ectopic site and assessed the effects on cleavage. Mutation of the pac2 A rich region from ATAAAAA to AgccAtg or insertion of 6 bases (ccatgg) adjacent to the pac2 A rich region blocked cleavage. Mutation of the pac2 CGCGGCG motif to attaatG reduced but did not eliminate cleavage. Mutation of the pac1 A rich region from ATCAAAATA to AtggcgtTc had no effect on cleavage. Two spontaneously occurring mutations, one deleting 23 bases between pac1 and the terminus (including part of the A rich motif), the other inserting 46 bases between pac1 and the terminus, blocked cleavage. We conclude that the A rich region of pac2 is essential for cleavage while the CGCGGCG motif enhances cleavage efficiency. The importance of pac1 remains to be clarified. Our data indicate the presence of essential cis sequences on the pac1 side of the cleavage site. Additional mutations will be constructed to define these essential sequences. We also found that the pac1 A rich region plays no role in cleavage. Strong conservation of this motif suggests it mediates some other important viral function such as circularization. The sequence elements that we have defined are highly conserved between diverse herpesviruses; therefore, our results should be relevant to other herpesviruses.
Infected and uninfected cell proteins bind specifically to distinct motifs within the murine cytomegalovirus (mCMV) pac1 sequence
Daniel E. Nixon and Michael A.
McVoy
21st International Herpesvirus
Workshop, DeKalb Illinois, 1996.
The conserved DNA sequences pac1 and pac2 have been implicated in cleavage and may play a role in packaging and circularization of herpesvirus genomes. Viral and cellular proteins have been shown to bind herpes simplex virus and human cytomegalovirus pac2 sequences but no specific binding to pac1 has been reported. The pac1 motif consists of a 5-7 bp A-rich region flanked on each side by 5-7 bp C runs. We used a double stranded oligonucleotide containing these motifs (GCCCCCCCATCAAAATACCCCCCCG) from the mCMV pac1 as a probe in gel mobility shift assays and identified two protein-DNA binding complexes, designated B and C in nuclear extracts of uninfected NIH3T3 cells. A third complex, designated complex A, was detected in mCMV infected cells and not in uninfected cells. Sequence specificity of all three complexes was confirmed by failure of a size and G/C content matched oligonucleotide with a scrambled sequence to compete for binding, even at a 600 molar excess. Complexes A and B were competed by a oligonucleotide containing a 6 bp mutation in the pac1 poly(C) motif (GCCCCCCCATCAAAATACCatggta) but were not competed by an oligonucleotide containing a 6 bp mutation in the pac1 A-rich motif (GCCCCCCCATggcgtTtCCCCCCCG), indicating that these complexes bind with high specificity to the A-rich region of the pac1 oligonucleotide. Complex C was competed by the oligonucleotide containing the A-rich region mutation but not by the oligonucleotide containing the poly(C) mutation, indicating that complex C binds with high specificity to the pac1 poly(C) region. We conclude that three protein complexes interact with two distinct sequence motifs within the mCMV pac1 sequence with a high degree of sequence specificity. Both the poly C and the A rich motifs bind cellular proteins, whereas the A-rich motif is associated with a viral protein or a cellular protein upregulated by viral infection. A cleavage site containing a the A-rich region mutation was cleaved efficiently in the context of the viral genome (McVoy and Mocarski, this meeting), suggesting that the viral or cellular proteins in complexes A and B, which bind to the A-rich region, do not function in cleavage. The importance of the poly C region has not been ascertained in this system. The high degree of sequence conservation suggests that the A-rich motif, and the proteins which bind to it, play an important role in viral replication. Studies to evaluate the role of this region in circularization are underway.
An infected cell protein complex binds specifically to a murine cytomegalovirus cis DNA element essential for concatemer cleavage
Daniel E. Nixon, Michael McVoy,
and Stuart P. Adler.
6th International CMV Workshop,
Orange Beach Alabama. 1997
The proteins required for herpesvirus concatemer cleavage are unknown; however two sequence elements, pac1 and pac2, are conserved at herpesvirus termini and may be binding sites for these proteins. Viral and cellular proteins bind to herpes simplex virus and human cytomegalovirus pac2 sequences but an association between in vitro binding and cleavage has not been demonstrated. Using double stranded oligonucleotide probes in gel mobility shift assays, we identified four protein-DNA binding complexes (designated A, B, C1, and C2) binding to a murine cytomegalovirus (mCMV) pac1 containing probe and two complexes (D and E) binding to a pac2 containing probe. Complex D was only detected in extracts from infected cells. The remaining complexes were detected in uninfected cells. Using competitor oligonucleotides with 4-6 bp mutations in additional gel shift experiments, the binding domain of each complex was mapped. The binding site for complex C1 competed for complex E binding and vice versa, suggesting that C1 and E are the same cellular complex which binds to both sides of the cleavage site. The D complex binding site mapped to the pac2 A-rich region. Two mutations which disrupted D complex binding in gel shift assays, when introduced to an ectopic cleavage site in mCMV, blocked cleavage at the ectopic site. Our experiments suggest that the proteins in complex D are required for cleavage. Recombinant viruses containing ectopic sites with mutations that block binding of the other complexes are being analyzed.
cis sequences mediating guinea pig cytomegalovirus (gpCMV) genome cleavage
Michael McVoy, Daniel E. Nixon,
and Stuart P. Adler
6th International CMV Workshop,
Orange Beach Alabama. 1997
Cleavage of gpCMV replicative concatemeric DNA occurs at one of two nearby sites which share repeated sequences on one side of the cleavage point but differ on the other. Therefore sequence elements essential for cleavage should be conserved within the regions which are different at the two sites. To test this we cloned and sequenced the ends of gpCMV virion DNA and reconstructed the sequences of the cleavage sites. One of the two cleavage sites was flanked by typical herpesvirus conserved sequences called pac1 and pac2 which may mediate cleavage. The region containing pac1 was the same at both cleavage sites. The region containing pac2 differed at the 2nd site but contained two homologous sequence elements. The 1st element had 6 identical bases 7 bp from the termini. The same 6 bp were also 7 bp from the termini of rat and murine CMVs but were not in other herpesviruses. The 2nd element had 9 of 11 bases identical to the pac2 region of the 1st site. When these homologous elements were displaced from the point of cleavage by insertion of a foreign gene in a recombinant virus, cleavage did not occur. When 64 bp of sequence which included the 6 bp and 11 bp elements was restored between the foreign gene and the cleavage point, cleavage occurred, demonstrating that cis cleavage elements exist within this 64 bp. As the 11 bp element corresponds to pac2, which is highly conserved at all herpesvirus termini, we propose that the 11 bp element is the essential cis cleavage element. If the 6 bp element is also involved in cleavage, it is unique to rodent CMVs.
Tetracycline regulation of reporter gene expression within the human cytomegalovirus genome
Michael A. McVoy and Edward S.
Mocarski
22nd International Herpesvirus
Workshop, San Diego California. 1997
Regulation of viral gene
expression through an inducible promoter such as the
tetracycline-inducible system1 would
be a highly desirable tool for investigating viral gene function since
complementing cell lines would not be needed and gene expression could
be regulated in a conditional manner during the replication cycle. To
investigate tetracycline (Tc) promoter regulation in the context of the
human cytomegalovirus (HCMV) genome, we made three recombinant viruses
containing luciferase under the control of different promoters: Phcmv*-1, which has seven copies of the Tc operator
upstream of a TAATA containing element from -53 to +75 of the HCMV
IE1/IE2 promoter1; P1125,
which has a TAATA element from the adenovirus major late promoter in
place of the HCMV TAATA; and P1129, which has a
single Tc opertator upstream of the HCMV TAATA. Tc regulation of
luciferase levels was evaluated when these viruses were used to infect
human fibroblasts that stably expressed tTA, a transactivator necessary
for Tc regulation1. At 72 hours post
infection, Tc most strongly repressed the P1125 promoter,
resulting in luciferase levels 50-fold lower than in the absence of Tc.
Expression from the Phcmv*-1
and P1129 promoters was less well regulated,
resulting in 10- and 2-fold differences, respectively, between
luciferase levels
in Tc treated and untreated infected cells. These results suggest that
the P1125 promoter may provide sufficient
conditional
expression of viral gene products to assess their roles in viral
replication.
1Gossen, M. and H. Bujard. 1992. PNAS
89:5547-5551
Guinea pig cytomegalovirus has two mechanisms of concatemer cleavage — one duplicates the terminal repeat, the other does not
Daniel E. Nixon and Michael A.
McVoy
22nd International Herpesvirus
Workshop, San Diego California. 1997
Sequence data from herpes simplex virus type-1 (HSV-1) and other herpesviruses suggest that cleavage of progeny genomes from replicative concatemers occurs by a single base staggered- cut, but because HSV-1 has at least one copy of the terminal repeat, or a sequence, at each end, this mechanism requires that cleavage occur between two a sequences. Junctions between genomes in HSV-1 concatemers, however, predominantly contain single a sequences. This, and the observation that single a sequences become amplified when introduced to ectopic locations in the HSV-1 genome or when used to generate amplicons, has led to the suggestion that cleavage duplicates terminal repeats. Guinea pig cytomegalovirus (GPCMV) has two genome structures: type I genomes have one repeat at the left end but lack a repeat at the right end; type II genomes have a single repeat at each end. Junctions within GPCMV concatemeric DNA contained both single and double repeats, such that type I genomes could arise from staggered-cut cleavage adjacent to single repeats and type II genomes could arise from staggered-cut cleavage between double repeats; however, the 1:1 ratio of type I to type II genomes did not correspond with the 4:1 ratio of single to double repeats in concatemeric DNA. A recombinant GPCMV that formed only type II genomes had only single repeats in its concatemeric DNA, indicating that for this virus, cleavage must duplicate the terminal repeat. A total absence of termini lacking a repeat in infected cell DNA suggests that this is not simply a consequence of alternate genomes being cleaved from the concatemer. Thus, although cleavage in GPCMV can occur by a staggered-cut mechanism, cleavage at single repeats can also occur by a mechanism that duplicates the repeat.
The direction of herpesvirus DNA concatemer cleavage/packaging is associated with pac2 cis cleavage/packaging elements.
Michael A. McVoy, Daniel E.
Nixon,
and Jae K. Hur.
FASEB Summer Research Conferences:
Virus Assembly. Saxon's River Vermont. 1998
Herpesviruses have large double
stranded linear DNA genomes that are formed by cleavage from complex
concatemeric intermediates. Cleavage leaves ends on concatemeric
DNA
similar to one of the two genomic
termini but not the other1-5,
suggesting that, like bacteriophage l, herpesvirus cleavage/packaging
occurs from concatemer ends one genome at a time and proceeds only in
one direction. Directionality in l results from binding of the
large subunit of terminase to concatemer ends and association of this
complex with the portal vertex of phage proheads prior to initiation of
packaging. If a similar process occurs in herpesviruses,
concatemer ends may contain binding sites for proteins involved in
initiation of packaging. The known herpesvirus cleavage/packaging
elements,
pac1 and pac2, lie at opposite ends of herpesvirus
genomes,
with the exception of human cytomegalovirus (CMV), in which putative pac1
and pac2 elements are adjacent at one end and absent from the
other.
Our previous work with human CMV concatemers detected a predominance of
ends which lack the putative pac1 and pac21. More recent reports for herpes simplex
virus type 12-4 and equine
herpesvirus type 15 indicate that ends containing pac2 are
associated with concatemers. To strengthen the association of pac2
with concatemer ends, we analyzed concatemeric DNA from murine CMV and
guinea pig CMV. In both cases, pac2 ends were found on
concatemers but pac1 ends were absent. Therefore, in four
different herpesviruses, concatemers contain pac2 ends but lack
pac1 ends, suggesting that pac2 is associated with the
directionality of cleavage/packaging and, by analogy to phage l,
may bind to specific protein factors to mediate initiation of packaging.
1McVoy, M. A. and S. P. Adler. 1994. J.Virol.
68:1040-1061. 2Martinez, R., R. Sarisky, P. Webber, and S. K. Weller. 1996.
J.Virol. 70:2075-2085. 3Severini, A., A. R. Morgan, D. R. Tovell, and D. L. J.
Tyrrell. 1994. Virology 200:428-436. 4Zhang, X., S. Efstathiou, and A. 9Simmons. 1994. Virology
202:530-539. 5Slobedman, B. and A. Simmons. 1997. Virology 229:415-420.
Head-full restriction of genome cleavage/packaging in murine cytomegalovirus (MCMV): a defense against defective genomes?
Carlos Berbes and Michael A. McVoy
23rd International Herpesvirus
Workshop, York UK. 1998
