The Laboratory of Michael McVoy
|
CMV
Cafe:
The Laboratory of Michael McVoy |
|
VIRGINIA COMMONWEALTH UNIVERSITY |
 |
How
to Contact Us
RESEARC INTERESTS
The mission of our laboratory is to improve human health by developing new tools to combat a very serious pathogen, human cytomegalovirus (HCMV). We are approaching this problem through two avenues: (1) understanding the basic mechanisms of herpesvirus genome cleavage and packaging, with an aim toward development of novel antiviral drugs; and (2) characterizing the immune evasion mechanisms employed by guinea pig cytomegalovirus (GPCMV), with an aim toward developing the GPCMV system as a model for testing genetically engineered human cytomegalovirus vaccines.
(1) Herpesvirus DNA cleavage and packaging
One of our first tasks was to map herpesvirus cis
cleavage/packaging sequences. Small mutations were introduced into
a second cleavage site within the murine cytomegalovirus (MCMV) genome.
Initial mutations identified two small sequence elements, one on each side
of the point of cleavage, that are required for efficient genome cleavage
and packaging [1]. Next, we initiated experiments with GPCMV to study
the mechanisms of DNA cleavage and packaging. We showed that cleavage
can occur by two pathways: one in which the DNA is cleaved by a simple
staggered cut and one in which terminal sequences are duplicated to form
terminal repeats [2]. Independent cis sequences appeared to mediate
these pathways since disruption of one cis element produced a virus that
only uses duplication-cleavage [3]. Perhaps most importantly, we
found that GPCMV is sensitive to an antiviral drug previously thought to
block genome cleavage and packaging only in HCMV. Studies of the
structure of GPCMV genomes that are packaged in the presence of this drug
revealed that (1) the DNA is truncated at one end; (2) the truncated DNA
is packaged within capsids that are not fully sealed (they are permeable
to nuclease); and (3) the abnormal capsids do not leave the nuclei of the
infected cells [4]. Additional studies using new compounds that appear
to function in somewhat different ways are currently underway.
Future plans include: a more detailed mutagenesis
in MCMV to precisely define the cis cleavage/packaging elements; expression
and biochemical characterization of certain viral proteins which have been
implicated in cleavage and packaging; detection of specific DNA intermediates
predicted by a model proposed for the mechanism of duplication; determination
of a role for viral or cellular DNA polymerases in duplication; and construction
of an additional GPCMV predicted to use only staggered cut cleavage such
that the two cleavage pathways can be studied independently.
(2) Immune evasion by GPCMV
Live attenuated HCMV vaccines are currently
under study [5]; however, HCMV is known to contain four genes that down-regulate
expression of class I on the surface of infected cells [6]. This
raises questions as to how viral down-regulation of class I impacts on
vaccine efficacy. Would a vaccine strain of virus genetically deleted
of the class I down-regulation genes be better able to present antigen
and thus to stimulate a stronger immune response? Or would unmasking
viral antigen presentation render the virus so vulnerable to immune clearance
that a weaker immune response might result? These are not questions
that can be readily addressed in the HCMV system. We therefore sought
to determine if GPCMV has the ability to down-regulate class I with the
aim to ultimately identify the viral genes responsible, delete these genes
from the viral genome, and test the effects of the deletions with respect
to induction of host immunity and vaccine efficacy. Our preliminary
data show quite clearly that GPCMV does down-regulate surface expression
of class I and that this is either an early or immediate early gene function
(viral DNA synthesis is not required for down-regulation). Efforts
are currently underway to characterize the mechanism(s) of down-regulation
and to determine the viral genes responsible.
1. McVoy, M.A., et al., Sequences within the herpesvirus-conserved pac1
and pac2 motifs are required for cleavage and packaging of the murine cytomegalovirus
genome. J Virol, 1998. 72(1): p. 48-56.
2. Nixon, D.E., J.K. Hur, and M.A. McVoy, Cleavage and packaging of
herpesvirus concatemeric DNA involves duplication of terminal repeat sequences.
manuscript in preparation.
3. McVoy, M.A., D.E. Nixon, and S.P. Adler, Circularization and cleavage
of guinea pig cytomegalovirus genomes. J Virol, 1997. 71(6): p. 4209-17.
4. Nixon, D.E., J.K. Hur, and M.A. McVoy, Dramatic effects of 2-bromo-5,6-dichloro-1-b-D-ribofuranosyl
benzimidazole riboside on the genome structure, packaging, and capsid egress
of guinea pig cytomegalovirus. manuscript in preparation.
5. Adler, S.P., et al., Safety and immunogenicity of the Towne strain
cytomegalovirus vaccine. Pediatr Infect Dis J, 1998. 17(3): p. 200-6.
6. Jones, T.R., et al., Multiple independent loci within the human
cytomegalovirus unique short region down-regulate expression of major histocompatibility
complex class I heavy chains. J Virol, 1995. 69(8): p. 4830-41.
Mailing Address:
Return to
Top
Michael McVoy
Department of Pediatrics
Medical College of Virginia
Virginia Commonwealth University
P.O. Box 980163 MCV Station
Richmond VA 23298-0163
phone: 804-828-0132
fax: 804-828-6455
e-mail: mmcvoy@hsc.vcu.edu
Federal Express Address:
Michael McVoy
Sanger Hall Room 12-014
1101 East Marshall Street
Richmond VA 23298
Michael McVoy
Assistant
Professor
Department
of Pediatrics and Microbiology & Immunology
B.S.
College of William and Mary
Ph.D.
Medical College of Virginia/Virginia Commonwealth University
Daniel
E. Nixon
Post-doctoral
Fellow
B.S.
Ohio State University
D.O.
Ohio University
Jianben Wang
Research Associate
M.D.
Harbin Medical Institute, Harbin P.R. China
M.S.
Shanxi Medical Institute, Taiyuan P.R. China
Juan Lacayo
Ph.D.
student, Department of Microbiology & Immunology
B.S.
Virginia Commonwealth University
Will
Bierach
B.S. Campbell University
Ian
McVoy
Fox
Elementary, Richmond Virginia
click here to view: Ian
Ian's mermaid
Ian's mummy
Former Lab Members
Carlos
Berbes
Ph.D.
student, Department of Microbiology & Immunology
B.S.
Virginia Commonwealth University
M.S.
Medical College of Virginia Campus of Virginia Commonwealth University
Jessica Abbate
Field Experience Student
Governor's School for Government and
International Studies
Currently a junior at The University
of Virginia
Dipti Ramnarain
Field Experience Student
Governor's School for Government and
International Studies
Currently a junior at The College of
William and Mary
Yulin Liu
Visiting Scientist
M.D. Xinjiang Medical University, Urumuqi
P.R. China
B.S. Xinjiang Medical University,
Urumuqi P.R. China
Jae Kyun Hur
Visiting
Scientist
M.D.
Catholic Medical College, Seoul Korea
Ph.D.
Catholic Medical College, Seoul Korea
Anupam Bapu Jena
Hs.D. (High School Diploma) Governor's School for Government and International
Studies
Class
of 2000, Massachusetts Institute of Technology
McVoy, M. and S.P. Adler.
1991. Analysis of human cytomegalovirus DNA replicative intermediates:
DNA forms not predicted by the rolling circle model. In M.P Landini
(ed.), Progress in cytomegalovirus research. Elsevier Science Publishers,
Amsterdam
Abstract
McVoy, M. and S.P. Adler. 1994. Human cytomegalovirus DNA replicates after early circularization by concatemer formation and inversion occurs within the concatemer. Journal of Virology, 68:1040-1051 Abstract
McVoy, M.A., Nixon, D.E., and
S.P. Adler. 1997. Circularization and cleavage of guinea
pig cytomegalovirus genomes.
Journal of Virology, 71:4209-4217 Abstract
McVoy, M.A., Nixon, D.E., Adler, S.P., and E.S. Mocarski. 1997. Sequences within the herpesvirus-conserved pac1 and pac2 motifs are required for cleavage and packaging of the murine cytomegalovirus genome. Journal of Virology, 72:48-56 Abstract
McVoy, M.A. and E.S. Mocarski. 1999. Tetracycline regulation of reporter gene expression within the human cytomegalovirus genome. Virology 258:295-303. Abstract
McVoy, Michael A., Daniel E. Nixon, Jay K. Hur, and Stuart P. Adler. 2000. The ends on herpesvirus DNA replicative concatemers contain pac2 cis cleavage/packaging elements and their formation is controlled by terminal cis sequences. Journal of Virology, 74:1587-1592. Abstract
McVoy, M.A. and D. Ramnarain. 2000. The machinery to support genome segment inversion exists in a herpesvirus which does not naturally contain invertible elements. Journal of Virology, 74:4882-7. Abstract
Abbate, J., J. C. Lacayo, M. Prichard, G. Pari, and M. A. McVoy.
2001. A bifunctional protein conferring enhanced green fluorescence
and puromycin resistance. BioTechniques, in press. Abstract
Selected Meeting Abstracts
McVoy, M. and S.P. Adler. 1991. Analysis of human cytomegalovirus DNA replicative intermediates: DNA forms not predicted by the rolling circle model. Third International Cytomegalovirus Workshop, Bologna Italy Abstract
McVoy, M. and S.P. Adler. 1992. Structural analysis of latent Epstein-Barr virus DNA. Plasmid, 28:180 Abstract
McVoy, M. and S.P. Adler. 1992. Analysis of human cytomegalovirus DNA replicative intermediates II: DNA forms early in the replicative cycle. 17th International Herpesvirus Workshop, Edinburgh Scotland Abstract
McVoy, M. and S.P. Adler. 1993. Detection of circular DNA early in the replication of human cytomegalovirus. 4th International Cytomegalovirus Conference, Paris France Abstract
McVoy, M. and S.P. Adler. 1993. Evidence for a concatemeric DNA replicative intermediate of human cytomegalovirus and inversion within the concatemer. 4th International Cytomegalovirus Conference, Paris France Abstract
McVoy, M. and S.P. Adler. 1994. Guinea pig cytomegalovirus (GPCMV) genomes circularize by end-to-end ligation. 19th International Herpesvirus Workshop, Vancouver B.C. Canada Abstract
McVoy, M.A. and E.S. Mocarski. 1995. pac1 is essential for cleavage/packaging in the context of a herpesvirus genome. 20th International Herpesvirus Workshop, Groningen The Netherlands Abstract
McVoy, M.A. and E.S. Mocarski. 1996. cis sequence requirements for herpesvirus genome cleavage. 21st International Herpesvirus Workshop, DeKalb Illinois Abstract
Nixon, D.E. and M.A. McVoy. 1996. Infected and uninfected cell proteins bind specifically to distinct motifs within the murine cytomegalovirus pac1 and pac2 sequences. 21st International Herpesvirus Workshop, DeKalb Illinois Abstract
Nixon, D.E., Adler, S.P, and M.A. McVoy. 1997. An infected cell protein complex binds specifically to a murine cytomegalovirus cis DNA element essential for concatemer cleavage. 6th International CMV Workshop, Orange Beach Alabama Abstract
Nixon, D.E., Adler, S.P, and M.A. McVoy. 1997. cis sequences mediating guinea pig cytomegalovirus (gpCMV) genome cleavage. 6th International CMV Workshop, Orange Beach Alabama Abstract
McVoy, M.A. and E.S.Mocarski. 1997. Tetracycline regulation of reporter gene expression within the human cytomegalovirus genome. 22nd International Herpesvirus Workshop, San Diego California Abstract
Nixon, D.E.and M.A. McVoy. 1997. Guinea pig cytomegalovirus has two mechanisms of concatemer cleavage one duplicates the terminal repeat, the other does not. 22nd International Herpesvirus Workshop, San Diego California Abstract
Michael A. McVoy, Daniel E. Nixon, and Jae K. Hur. 1998. The direction of herpesvirus DNA concatemer cleavage/packaging is associated with pac2 cis cleavage/packaging elements. FASEB Summer Research Conferences: Virus Assembly. Saxon's River Vermont Abstract
Carlos Berbes and Michael A. McVoy. 1998. Head-full restriction of genome cleavage/packaging in murine cytomegalovirus (MCMV): a defense against defective genomes? 23rd International Herpesvirus Workshop, York UK Abstract
Daniel E. Nixon, Jae K. Hur, and Michael A. McVoy. 1998. The cleavage inhibitor BDCRB alters the equilibrium of cleavage from staggered-cut to terminal repeat duplication in both guinea pig cytomegalovirus (GPCMV) and human cytomegalovirus (HCMV). 23rd International Herpesvirus Workshop, York UK Abstract
Michael A. McVoy. 1998. Evidence that a cellular DNA polymerase is involved in cleavage of human cytomegalovirus (HCMV) genomes from replicative concatemers. 23rd International Herpesvirus Workshop, York UK Abstract
Michael A. McVoy. 1999. Evidence that human cytomegalovirus DNA cleavage involves a cellular DNA polymerase. 7th International CMV Workshop, Bristol UK Abstract
McVoy, Michael A. and Daniel E. Nixon. 2000. Dramatic effects of the maturational inhibitor BDCRB on herpesvirus genome structure and packaging. FASEB Summer Research Conferences: Virus Assembly. Saxon's River Vermont Abstract
Wang, Jian Ben, Giovanni Nigro, Michael A. McVoy, and Stuart P. Adler. 2000. High levels of serum antibody to human cytomegalovirus (HCMV) pUL89 are associated with severe primary HCMV infection during pregnancy. 25th International Herpesvirus Workshop. Portland OR Abstract
Berbes, Carlos, Gabriele Hahn, and Michael A. McVoy. 2000. Rapid insertion of DNA sequences to a bacmid-cloned herpesvirus genome using Tn7-mediated transposition. 25th International Herpesvirus Workshop. Portland OR Abstract
Lacayo, Juan C., Mark Prichard, and Michael A. McVoy. 2000. Rapid construction of a recombinant herpesvirus using a bifunctional fusion protein expressing green flourescent protien and puromycin resistance. 25th International Herpesvirus Workshop. Portland OR Abstract
Nixon, Daniel E., and Michael A. McVoy. 2000. Dramatic effects of the maturational inhibitor BDCRB on genome structure and packaging of guinea pig cytomegalovirus. 25th International Herpesvirus Workshop. Portland OR Abstract
Lacayo, Juan C., and Michael A. McVoy. 2001. MHC class I down-regulation by guinea pig cytomegalovirus. 8th International Cytomegalovirus Workshop. Monterey California. Abstract
Publication Abstracts
Analysis of human cytomegalovirus (HCMV) DNA replicative intermediates: DNA forms not predicted by the rolling circle model
Michael A. McVoy and Stuart P. Adler. In M.P Landini (ed.), Progress in Cytomegalovirus Research. Elsevier Science Publishers, Amsterdam. 1991.
INTRODUCTION The mechanism of HCMV DNA replication has not been studied in detail but has generally been assumed to be similar to that of Herpes Simplex Virus (HSV). HSV DNA is replicated via a large primary replicative intermediate (PRI) that lacks terminal restriction fragments. The structure of this PRI has not been conclusively established; however, it is likely to be one of two possibilities: i) a head to tail concatemer generated by a rolling circle mechanism or ii) interlocked unit length circles generated by theta replication1. To determine if HCMV DNA is replicated through a similar PRI, we characterized the replicative intermediates following field inversion gel electrophoresis (FIGE).
MATERIALS AND METHODS Infection and Preparation of DNA Human MRC-5 fibroblasts were infected with strain AD169 at an moi of 0.5-1.0. Cells were washed with PBS, scraped, pelleted, re-suspended in 30ul melted 1% seaplaque agarose (FMC) in TE and cast into plugs. Plugs were incubated 48h at 50 C in 0.5ml TE 1% sarkosyl 1ug/ml proteinase K and dialyzed 3x2h with TE and stored at 4 C. Field Inversion Gel Electrophoresis FIGE was performed at 10 C using 0.5X TBE in a horizontal agarose gel electrophoresis box. DNA samples were melted at 65 C and loaded into wells using a wide bore pipet tip. Forty milliliter (8x11cm) gels were run at 80V for 20h with pulses starting at 5s, increasing to 45s and a forward to backward ratio of 3:1. One hundred milliliter (11x14cm) gels were run at 120V for 36h with pulses starting at 5s and increasing to 60s. Southern Hybridization FIGE separated DNA was transferred to Nytran (Schleicher and Schuell) by capillary blotting, UV cross-linked (0.12 J/cm2) and hybridized according to the manufacturer's instructions. Probes were random hexamer labeled (Boehringer Mannheim kit) with 32P dCTP (106 cpm/hybridization). Terminal fragment analysis DNA from cells 5 days post-infection (PI) were separated by FIGE in duplicate on a 40ml 1% seaplaque gel. One lane was cut from the gel and dialyzed 3x30min with 1X EcoRI buffer, then digested for 16h at 37 C with 2500U EcoRI. The digested gel slice was cast laterally into a 100ml 1% agarose gel and separated in a second dimension by FIGE at 120V for 20 h. Pulses increased from 0.1 to 2.0s with forward to backward ratio of 2:1. The gel was aligned with the undigested duplicate lane and overlaid with 1% agarose. The composite gel was blotted and sequentially hybridized with probes (fig.1) specific for the long arm terminal fragment W (pON227), the short arm terminal fragments N and L (Towne XbaI I in pACYC184), or a long unique region control (Towne XbaI E in pACYC184). -irradiation DNA plugs from cells 5 days PI were separated by FIGE on a 40ml gel and the positions of DNA forms were determined by ethidium bromide staining of lanes cut from each edge of the gel. DNA forms were cut into blocks, placed in microfuge tubes containing 1 ml TE, and -irradiated using a CES-I- RAD 1000 137Cs/134Cs source. Irradiated blocks were cast into a 100ml gel and separated by FIGE. Gels were blotted and probed with the Towne XbaI E fragment.
RESULTS DNA prepared five days PI contains four HCMV DNA forms: a high molecular weight (HMW) form that does not migrate from the loading well, an approximately 1000 kb form, a 500-600 kb form, and a unit-length form of 230 kb (fig.2 lane 5). DNA from uninfected cells did not hybridize with the probe. Time course DNA was prepared from cultures one hour PI and each day thereafter. DNA was separated by FIGE, Southern blotted and probed with the XbaI E fragment (fig.2). Viral DNA is first detected in the HMW form 48h PI. Unit length DNA is first detected on day 4 and the 500-600 kb and 1000 kb forms are first detected on day 5. Pulse labeling experiments using 32P phosphate confirmed that the HMW form is first synthesized at about 36-48h PI and is subsequently processed to the smaller forms (data not shown). Terminal Fragment Analysis Probing for the short arm EcoRI terminal fragments N and L with the XbaI I probe (fig.1) reveals that only unit length DNA has short arm termini (N and L are not detected in HMW, 1000 kb, and 500-600 kb DNA but are detected in unit length DNA, not shown). Reprobing for the long arm EcoRI terminal fragment W with the pON227 probe reveals that only unit length DNA has long arm termini (W is not detected in HMW, 1000 kb or 500-600 kb DNA but is detected in unit length DNA, not shown). Reprobing with a long unique region fragment (XbaI E) demonstrates that all four forms have the four EcoRI fragments that overlap with XbaI E (not shown).
-Irradiation Analysis Low dose -irradiation was used to distinguish circular from linear DNA forms (unit sized circles are converted to unit length linear molecules by a single double-stranded break; linear molecules are broken into random-length fragments2). -irradiation of 230 kb and 1000 kb DNA produced a shearing pattern consistent with linear DNA - even smearing with no discrete bands produced (not shown). -irradiation of 500-600 kb DNA produced a band of 230 kb, suggesting that 500-600 kb DNA is composed, at least in part, of unit length circles (not shown). No discrete bands of any size are produced by -irradiation of HMW DNA, indicating that it is not composed of interlocked circles (not shown).
DISCUSSION Our results indicate that the HMW DNA is the primary replicative intermediate of HCMV: it is synthesized first, is large, and lacks termini. It is not composed of interlocked circles and may be a long linear concatemer. The 500-600 kb and 1000 kb DNA forms lack termini and are therefor not products of incomplete cleavage (dimers and tetramers) of a concatemer. Such molecules should have terminal fragments albeit at reduced molar ratios. The 1000 kb form is apparently linear. Its role in the replicative process, if any, is unknown. The 500-600 kb DNA is composed in part of unit length circles and is present in low but significant amounts. Two models satisfy the current data on Herpesvirus DNA replication: (1) the rolling circle model, which is generally favored, suggests that the PRI is a long linear concatemer of head to tail linked genomes; (2) the theta replication model suggests that the PRI is composed of interlocked unit length circles1. Our observation that the HMW DNA is not composed of interlocked circles clearly rules out the theta replication model for HCMV; however, the presence of significant amounts of unit length circular DNA is not consistent with the rolling circle model. The presence of these circles suggests that replication may proceed in a process analogous to that of E. coli phage Lambda3 in which the linear genome circularizes and replicates first by theta replication producing unit length circles. Late in infection replication switches to rolling circle, using the unit length circles produced by early theta replication as templates.
Human cytomegalovirus DNA replicates after early circularization by concatemer formation and inversion occurs within the concatemer
Michael A. McVoy and Stuart P. Adler. 1994. Journal of Virology, 68:1040-1051.
To determine the replicative mechanism for human cytomegalovirus (HCMV) DNA, field- inversion gel electrophoresis was used to separate HCMV replicative DNAs during lytic infection. Unit length circular HCMV genomes lacking terminal restriction fragments were detected starting four hours after infection even when cells were treated with aphidicolin, phosphonoacetic acid, or cycloheximide. Viral DNA synthesis began 24 hours after infection and produced large amounts of high molecular weight replicative DNA that was a precursor of progeny genomes. Replicative DNA contained rare terminal restriction fragments and long arm termini were much less frequent than short arm termini. Replicative DNA was not composed of unit length circles because low dose -irradiation of replicative DNA generated numerous random high molecular weight fragments rather than unit length molecules. PacI digestion of replicative DNA from a recombinant HCMV with two closely spaced PacI sites revealed that replicative DNA is concatemeric and genome segment inversion occurs after concatemer synthesis. These results show that after circularization of the parental genome, DNA synthesis produces concatemers by a rolling circle mechanism and genomic inversion occurs within concatemeric DNA. The results further suggest that concatemers acquire genomic termini during the cleavage/packaging process which preferentially inserts short arm termini into empty capsids causing a predominance of short arm termini on the concatemer.
Circularization and cleavage of guinea pig cytomegalovirus genomes
Michael A. McVoy, Daniel E. Nixon, and Stuart P. Adler. 1997. Journal of Virology,71:4209-4217.
The mechanisms by which herpesvirus genome ends are fused to form circles after infection and are re-formed by cleavage from concatemeric DNA are unknown. We used the simple structure of guinea pig cytomegalovirus genomes, which have either one repeated DNA sequence at each end or one repeat at one end and no repeat at the other, to study these mechanisms. In circular DNA, two restriction fragments contained fused terminal sequences and had sizes consistent with the presence of single or double terminal repeats. This result implies a simple ligation of genomic ends and shows that circularization does not occur by annealing of single stranded terminal repeats formed by exonuclease digestion. Cleavage to form the two genome types occurred at two sites and homologies between these sites identified two potential cis elements that may be necessary for cleavage. One element coincided with the A rich region of a pac2 sequence and had 9 of 11 bases identical between the two sites. The second element had 6 bases identical at both sites, in each case 7 bp from the termini. To confirm the presence of ciscleavage elements, a recombinant virus was constructed in which foreign sequences displaced the 6 and 11 bp elements 1 kb from the cleavage point. Cleavage at the disrupted site did not occur. In a second recombinant virus, restoration of 64 bases containing the 6 and 11 bp elements to the disrupted cleavage site restored cleavage. Therefore, cis cleavage elements exist within this 64 base region and sequence conservation suggests that they are the 6 and 11 bp elements.
Sequences within the Herpesvirus-conserved pac1 and pac2 Motifs are Required for Cleavage and Packaging of the Murine Cytomegalovirus Genome
Michael A. McVoy, Daniel E. Nixon, Stuart P. Adler, and Edward S. Mocarski. Journal of Virology, 72:48-56
The DNA sequence motifs pac1 (an A-rich region flanked by poly(C) runs) and pac2 (CGCGGCG near an A-rich region) are conserved near herpesvirus genomic termini and are believed to mediate cleavage of genomes from replicative concatemers. To determine their importance in the cleavage process, we constructed a number of recombinant murine cytomegaloviruses with a second cleavage site inserted at an ectopic location within the viral genome. Cleavage at a wild type ectopic site occurred as frequently as at the natural cleavage site, whereas mutation of this ectopic site revealed that some of the conserved motifs of pac1 and pac2 were essential for cleavage while others were not. Within pac1, the left poly(C) region was very important for cleavage and packaging but the A-rich region was not. Within pac2, the A- rich region and adjacent sequences were essential for cleavage and packaging and the CGCGGCG region contributed to, but was not strictly essential for, efficient cleavage and packaging. A second A-rich region was not important at all. Duplication and deletion of the murine cytomegalovirus 30 bp terminal repeat was found to be contingent on cleavage. Plasmids used for virus construction contained either one or two copies of the 30 bp terminal repeat, whereas viral genomes with cleavage competent ectopic sites contained a mixture of single and double repeats. Sites with mutations that prevented cleavage retained the characteristic number of 30 bp repeats found in the plasmids used for their construction. Given that the processes of genome cleavage and packaging appear to be highly conserved among herpesviruses, these findings should be relevant to other members of this family.
Tetracycline regulation of reporter gene expression within the human cytomegalovirus genome
Michael A. McVoy and Edward S. Mocarski. Virology 258:295-303
Conditional control of gene expression
using an exogenous agent such as the antibiotic tetracycline has the potential
to impact the study of gene functions encoded by large viral genomes.
Expression of the luciferase gene luc under the control of derivatives
of the tetracycline-regulatable promoter PhCMV*-1 was studied in uninfected
and human cytomegalovirus-infected human fibroblast cells stably expressing
tTA, a chimeric regulatory protein that activates by binding to tet operator
sites (Gossen, M., and H. Bujard. 1992. Proc Natl Acad Sci USA 89:5547-51).
In uninfected fibroblasts, tetracycline mediated a 15- to 20-fold change
in luciferase levels; however, viral infection alone activated expression
of PhCMV*-1 several hundred-fold. In an effort to derive promoters
with greater differential regulation by tetracycline in virus-infected
cells, PhCMV*-1 was modified to create additional promoter constructs.
Two were characterized in detail by transient assay and introduction into
the viral genome: P1125 contains seven tTA binding sites upstream of promoter
sequences from the adenovirus major late promoter and an initiator from
terminal deoxynucleotidyltransferase and exhibited a higher degree of tetracycline
control as well as a high level of activation by viral infection; P1129
contains a single tTA binding site in the context of the human cytomegalovirus
ie1/ie2 promoter and exhibited reduced activation by viral infection and
poor differential regulation. In the context of the viral genome,
P1125 displayed nearly 100-fold regulation by tetracycline during late
times of infection, whereas PhCMV*-1 and P1129 exhibited regulation of
only two- to eight-fold. Significant luciferase expression and six-fold
levels of differential tetracycline regulation were observed for P1125
during early times of infection. The effects of adding or removing
tetracycline were fully reversed within 12 to 24 h. These results
suggest that the P1125 promoter may provide sufficient conditional expression
to effectively regulate human cytomegalovirus early or late genes.
The ends on herpesvirus DNA replicative concatemers contain pac2 cis cleavage/packaging elements and their formation is controlled by terminal cis sequences
Michael A. McVoy, Daniel E. Nixon, Jay K. Hur, and Stuart P. Adler. Journal of Virology, 74:1587-1592.
Herpesviruses have large double-stranded linear DNA genomes that are formed by site-specific cleavage from complex concatemeric intermediates. In this process only one of the two genomic ends are formed on the concatemer. Although the mechanism underlying this asymmetry is not known, one explanation is that single genomes are cleaved off of concatemer ends in a preferred direction. This implies that cis elements control the direction of packaging. Two highly conserved cis elements named pac1 and pac2 lie near opposite ends of herpesvirus genomes and are important for cleavage and packaging. By comparison of published reports and by analysis of two additional herpesviruses, we found that pac2 elements lie near the ends formed on replicative concatemers of four herpesviruses: herpes simplex virus type 1, equine herpesvirus type 1, guinea pig cytomegalovirus, and murine cytomegalovirus. Formation of pac2 ends on concatemers depended on terminal cis sequences, since ectopic cleavage sites engineered into the murine cytomegalovirus genome mediated formation of pac2 ends on concatemers regardless of the orientation of their insertion. These findings are consistent with a model in which pac2 elements at concatemer ends impart a directionality to concatemer packaging by binding proteins that initiate insertion of concatemer ends into empty capsids.
The machinery to support genome segment
inversion exists
in a herpesvirus which does not naturally contain
invertible elements
Michael A. McVoy and D. Ramnarain. Journal of Virology, 74:4882-7
In many herpesviruses genome segments flanked by inverted repeats invert during DNA replication. It is not known whether this inversion is a consequence of an inherently recombinagenic replicative mechanism common to all herpesviruses, or whether the replication enzymes of viruses with invertible segments have specifically evolved additional enzymatic activities to drive inversion. By artificially inserting a fusion of terminal sequences into the genome of a virus which normally lacks invertible elements (murine cytomegalovirus), we created a genome comprised of long and short segments flanked by 1,359- and 543-bp inverted repeats. Analysis of genomic DNA from this virus revealed that inversion of both segments generates equimolar amounts of four isomers during the viral propagation necessary to produce DNA for analysis from a single viral particle. We conclude that a herpesvirus which naturally lacks invertible elements is able to support efficient segment inversion. Thus, the potential to invert is probably inherent in the replication machinery of all herpesviruses, irrespective of genome structure, and therefore, genomes with invertible elements could have evolved simply by acquisition of inverted repeats and without concomitant evolution of enzymatic activities to mediate inversion. Furthermore, the recombinagenisity of herpesviral DNA replication must have some importance independent of genome segment inversion.
A bifunctional protein conferring
enhanced green fluorescence
and puromycin resistance
Jessica Abbate, Juan C. Lacayo, Mark Prichard, Gregory Pari, and Michael A. McVoy. BioTechniques, in press
A new genetic marker was created in which sequences from enhanced green fluorescent protein were fused to those of puromycin N-acetyl transferase. The resulting fusion protein (EGFP-puro) conferred both green fluorescence and resistance to puromycin when expressed in mammalian cells. The utility of EGFP-puro as a selectable/screenable marker was demonstrated by the ease in which a recombinant guinea pig cytomegalovirus containing EGFP-puro was isolated by a combination of puromycin selection and screening for green fluorescence. We conclude that EGFP-puro is a compact and versatile marker that should prove useful for recombinant virus and transgenic cell line construction, particularly in applications where coding capacity is limited.
Meeting abstracts
Analysis of human cytomegalovirus (HCMV) DNA replicative intermediates: DNA forms not predicted by the rolling circle model
Michael A. McVoy and Stuart P. Adler.
Third International Cytomegalovirus
Workshop, Bologna, Italy, 1991
Little is known about the structural intermediates of HCMV replication. The rolling circle model predicts a long linear concatemer, however, an intermediate of interlocked unit length circles resulting from a theta replicative mechanism would also have a high apparent molecular weight and lack terminal nts. We used field inversion gel electrophoresis (FIDE) separation of infected cell DNA o study the intermediates of HCMV replication. Southern hybridization of FIDE separated DNA from 5 day infected fibroblasts revealed four forms of HCMV DNA with apparent molecular weights of 230 kb, 500-600 kb, 1.1-1.6 Mb, and a high molecular weight form (>1.9 Mb). A pulse labeling time course revealed that the high molecular weight (HMW) form becomes labeled first, at 31-48 hours, and can be chased into the smaller forms. Terminal restriction fragment analysis revealed that only the 230 kb form contains long and short arm terminal fragments. Low dose gamma irradiation was used to differentiate circular from linear DNA forms (unit sized circles are converted to unit length linear molecules by a single double stranded break; linear molecules are broken into random length fragments). The four forms of viral DNA were first separated by FIGE and cut from the gel in agarose plugs. Following gamma irradiation of the agarose plugs at various doses, the DNA was analyzed by FIGE. Gamma irradiation converted the 500-600 kb DNA to 230 kb, indicating that it is composed of 230 kb (unit length) circles; however, gamma irradiation did not convert 1.1-1.6 Mb DNA to 230 kb, indicating this form was initially linear. Gamma irradiation of HMW DNA did not result in the release of unit length molecules; therefore, the HMW DNA is not composed of interlocked circles and is likely to be the long linear concatemer predicted by the rolling circle model. However, the significant amounts of unit length circles and 1.1-1.6 Mb linear molecules lacking terminal fragments cannot be explained by the rolling circle model and indicae that HCMV replication has additional complexity.
Structural analysis of latent Epstein-Barr virus (EBV) DNA.
M.A. McVoy and S.P. Adler. Plasmid, 28:180.1992.
During latent infection of human B cells, the EBV genome is believed to exist as a 170 kb circular molecule. We investigated the structure of latent EBV DNA in the Raji cell line utilizing g-radiation induced DNA cleavage and field-inversion gel-electrophoresis (FIGE). DNA prepared from Raji cells was separated by FIGE. EBV DNA was detected by hybridization with the cloned EBV BamHI W fragment. EBV DNA did not migrate from the wells of the FIGE gel, suggesting that the EBV DNA circles are be interlocked with other EBV genomes or with cellular DNA. If latent EBV DNA is composed of interlocked circles, a low dose of g-radiation should cleave some circles only once, releasing unit length (170 kb) linear DNA from the interlocked form. Raji cell DNA was exposed to increasing amounts of g-radiation, separated by FIGE, and hybridized as before. EBV DNA which remained in the well in the absence of g-radiation was converted by g-irradiation to a form that migrated with a molecular weight of approximately 170 kb. These results provide strong physical evidence that latent EBV genomes are circular and further indicate that they are interlocked, either with other EBV genomes or with chromosomal DNA.
Analysis of human cytomegalovirus (HCMV) DNA replicative intermediates II: DNA forms early in the replicative cycle
M.A. McVoy and S.P. Adler.
17th International Herpesvirus Workshop,
Edinburgh, Scotland, 1992.
We have previously described four HCMV (AD169) DNA forms, separable by field- inversion gel electrophoresis (FIGE), 5 days after infection of permissive human fibroblast cells: (i) a "230 kb" unit length linear DNA; (ii) a "500 kb" DNA, probably composed in part of 230 kb circles because it converts to 230 kb linear DNA spontaneously and upon g-irradiation; (iii) a "1 Mb" apparently linear DNA; and (iv) a "Late High Molecular Weight (HMW)" DNA that fails to migrate from the sample well, lacks terminal restriction fragments, but is not composed of unit length circles. We now report our analysis of the HCMV DNA forms found early in the replicative cycle. At 3 h post infection (PI), HCMV DNA was predominantly unit length linear and non-encapsidated (230 kb, normal terminal restriction fragments, nuclease sensitive). By 24 h PI, HCMV DNA appeared in a form that failed to migrate from the sample well. Infection with 32P labeled virions showed that input virion DNA is "converted" to this "Early HMW" form starting at 6 h PI. Early HMW DNA lacked terminal restriction fragments. Low dose g-irradiation of Early HMW DNA resulted in a high molecular weight smear, indicating that it is not composed of circular molecules and may be concatemeric. Production of Early HMW DNA was not inhibited by phosphonoacetic acid (PAA), cycloheximide, or aphidocolin. In contrast, synthesis by viral DNA polymerase, producing Late HMW DNA, was apparent by 48 h and was inhibited by both cycloheximide and PAA, but not aphidocolin. 500 kb and 1 Mb DNA were not detected prior to 72 h PI. We detected no stable HCMV DNA circles early in infection, indicating a lack of early replication. The conversion of input DNA to Early HMW DNA involves loss of termini and possible concatemerization but does not require protein synthesis of viral or host factors, host DNA polymerase (aphidocolin sensitive), or viral DNA polymerase (PAA sensitive). We were not able to structurally distinguish Early HMW from Late HMW DNA: both lacked termini, failed to migrate into FIGE gels, and smeared following g-irradiation.
Detection of circular DNA early in the replication of human cytomegalovirus (HCMV)
Michael A. McVoy and Stuart P. Adler.
4th International Cytomegalovirus
Conference, Paris France, 1993.
We have previously found that, by 24 hours after infection, linear 230 kb viral DNA is converted to a high molecular weight form (Early HMW DNA) that does not migrate from the sample well of a field-inversion gel, and that formation of Early HMW DNA is not inhibited by cycloheximide, phosphonoacetic acid, or 5 µg/ml aphidicolin. Furthermore, g-irradiation failed to reveal evidence for circular forms. We now report that when Tris/EDTA buffer is used to wash cells prior to DNA preparation, g-irradiation of Early HMW DNA results in a dose responsive release of 230 kb DNA (indicating the presence of unit circular forms early in infection), and high molecular weight smearing (suggestive of long linear forms). In addition, 10 µg/ml aphidicolin inhibited the formation of Early HMW DNA. These results indicate that Early HMW DNA is a mixture of circular and concatemeric forms synthesized by host DNA polymerases (aphidicolin sensitive, phosphonoacetic acid insensitive). We propose that HCMV DNA circularizes shortly after infection and undergoes early rolling circle replication mediated by host DNA polymerases, which are latter replaced by viral DNA polymerase.
Evidence for a concatemeric DNA replicative intermediate (RI) of human cytomegalovirus (HCMV) and inverstion within the concatemer
Michael A. McVoy and Stuart P. Adler.
4th International Cytomegalovirus
Conference, Paris, France, 1993.
If the herpesvirus RI is a head-to-tail linked concatemer produced by rolling circle replication, it is not known whether inversion occurs before or after formation of the concatemer. To answer these questions, we constructed a recombinant HCMV virus, MTO-1, containing two closely spaced novel PacI restriction sites, then isolated RI DNA by field-inversion gel electrophoresis (FIGE), digested the RI DNA with PacI, and separated the resulting fragments again by FIGE. The major species was the expected 230 kb fragment resulting from cleavage of the RI into unit length molecules. A 370 kb fragment, predicted if inversion results in different long arm isomers adjacent within a concatemer, was present in less than equimolar amounts. Because rolling circle replication of a unit circular template should result in homogeneous concatemers, all genome copies within a given concatemer should be the same isomeric form as the template. The presence of the 370 kb PacI fragment indicates that replicative DNA is heterogeneous, in that some genome copies have undergone inversion of the long arm. We conclude that the HCMV RI is concatemeric, to the extent that DNA molecules greater than unit length (370 kb) can be detected, and that inversion can occur during or after rolling circle replication.
Guinea pig cytomegalovirus (GPCMV) genomes circularize by end-to-end ligation
Michael A. McVoy and Stuart P. Adler.
19th International Herpesvirus Workshop,
Vancouver B.C., Canada, 1994.
The GPCMV genome has either single 1kb repeats at each terminus or a single repeat at one terminus and no repeat at the other. Genome circularization by annealing of complementary single stranded termini created by exonuclease digestion of terminal repeats predicts only single repeat copies in circular DNA; circularization by annealing and ligation of single base pair complementary overhangs predicts tandem repeat copies. We used pulsed-field electrophoresis to separate circular from linear DNA in cells infected with GPCMV in the presence of DNA synthesis inhibitors. After separation, terminal and junction restriction fragments were detected by hybridization. Two junction fragments were detected in circular DNA. The molecular weight of the smaller fragment was consistent with the presence of a single repeat and that of the larger fragment was consistent with tandem repeats. Neither junction fragment was detected in DNA prepared from the inoculum. Detection of the fragment containing tandem repeats excludes exonuclease digestion and supports end-to-end ligation as the mechanism of circularization. Therefore, the fragment containing a single repeat arises from circularization of genomes lacking a terminal repeat. This further implies that cleavage can occur at single repeats, resulting in functional genomes which lack a repeat at one terminus.
pac1 is essential for cleavage/packaging in the context of a herpesvirus genome
Michael A. McVoy and Edward Mocarski.
20th International Herpesvirus Workshop,
Gronigen, Netherlands, 1995.
cis-acting sequences pac1 and pac2 at the termini of herpesvirus genomes have been implicated in genome cleavage and packaging from concatameric replicative DNA intermediates. Although deletions of the pac1 and pac2 from the herpes simplex virus (HSV) a sequence abrogate cleavage, mutations specifically targeting the conserved motifs of pac1 and pac2 have not been tested. We constructed a recombinant murine cytomegalovirus (mCMV) containting an ectopic cleavage site to enable the selective disruption of pac1 and pac2. This created a second "cleavage frame" in concatameric DNA. A 1.9 kB fragment, derived from replicative DNA and containing fused termini, was placed beside an expression cassette for the E.coli gpt gene. These sequences were inserted into the viral genome at the site between the Hind III fragments L and J. Recombinant viruses were constructed by transfection of plasmid DNA followed by superinfection and three rounds of selection for gpt expression with mycophenolic acid and xanthine. Viruses were purified by limiting dilution and screened by Southern hybridization with a proble flanking the insertion site. All viral isolates carrying the insertion had equimolar amounts of the 7.6 kbp and 5.6/2.0 kbp BamHI restriction fragments that contained the insertion, indicating that cleavage occurred in the added site with efficiency equal to that of the natural cleavage/packaging site. Cleavage was observed whether the inserted fused termini had one or two copies of a 30 bp motif (GGGGGGCCCGCGCGCACTCAGACGGCCGGG) normally located at the mature genome termini. A mutation introduced into pac1, containing an ectopic cleavage site that failed to be recognized by the cleavage/packaging machinery. These studies demonstrate that the 1.9 kb fragment containing fused termini carries all the signals necessary for efficient cleavage and packaging, and that the pac1 A rich motif plays an essential role in this process. Analysis of mutations within the 30 bp repeat as well as within pac2 are under construction and will be presented.
cis sequence requirements for herpesvirus genome cleavage
Michael McVoy and Edward Mocarski.
21st International Herpesvirus Workshop,
DeKalb Illinois, 1996.
Two conserved sequence motifs, pac1 and pac2, are found at herpesvirus genomic termini. The murine cytomegalovirus (mCMV) pac1 consists of the sequence CCCCCCCATAAAATACCCCCCC. pac2 consists of CGCGGCG separated from an A rich region by 43 non-conserved bases. The proximity of pac1 and pac2 to the genomic termini (30-35 bp) suggest they may function in cleavage of progeny genomes from replicative concatemers. We inserted a second "ectopic" cleavage site into the mCMV genome and found that it was cleaved efficiently. To ascertain whether pac1 or pac2 are essential for cleavage, we introduced mutations to the ectopic site and assessed the effects on cleavage. Mutation of the pac2 A rich region from ATAAAAA to AgccAtg or insertion of 6 bases (ccatgg) adjacent to the pac2 A rich region blocked cleavage. Mutation of the pac2 CGCGGCG motif to attaatG reduced but did not eliminate cleavage. Mutation of the pac1 A rich region from ATCAAAATA to AtggcgtTc had no effect on cleavage. Two spontaneously occurring mutations, one deleting 23 bases between pac1 and the terminus (including part of the A rich motif), the other inserting 46 bases between pac1 and the terminus, blocked cleavage. We conclude that the A rich region of pac2 is essential for cleavage while the CGCGGCG motif enhances cleavage efficiency. The importance of pac1 remains to be clarified. Our data indicate the presence of essential cis sequences on the pac1 side of the cleavage site. Additional mutations will be constructed to define these essential sequences. We also found that the pac1 A rich region plays no role in cleavage. Strong conservation of this motif suggests it mediates some other important viral function such as circularization. The sequence elements that we have defined are highly conserved between diverse herpesviruses; therefore, our results should be relevant to other herpesviruses.
Infected and uninfected cell proteins bind specifically to distinct motifs within the murine cytomegalovirus (mCMV) pac1 sequence
Daniel E. Nixon and Michael A. McVoy
21st International Herpesvirus Workshop,
DeKalb Illinois, 1996.
The conserved DNA sequences pac1 and pac2 have been implicated in cleavage and may play a role in packaging and circularization of herpesvirus genomes. Viral and cellular proteins have been shown to bind herpes simplex virus and human cytomegalovirus pac2 sequences but no specific binding to pac1 has been reported. The pac1 motif consists of a 5-7 bp A-rich region flanked on each side by 5-7 bp C runs. We used a double stranded oligonucleotide containing these motifs (GCCCCCCCATCAAAATACCCCCCCG) from the mCMV pac1 as a probe in gel mobility shift assays and identified two protein-DNA binding complexes, designated B and C in nuclear extracts of uninfected NIH3T3 cells. A third complex, designated complex A, was detected in mCMV infected cells and not in uninfected cells. Sequence specificity of all three complexes was confirmed by failure of a size and G/C content matched oligonucleotide with a scrambled sequence to compete for binding, even at a 600 molar excess. Complexes A and B were competed by a oligonucleotide containing a 6 bp mutation in the pac1 poly(C) motif (GCCCCCCCATCAAAATACCatggta) but were not competed by an oligonucleotide containing a 6 bp mutation in the pac1 A-rich motif (GCCCCCCCATggcgtTtCCCCCCCG), indicating that these complexes bind with high specificity to the A-rich region of the pac1 oligonucleotide. Complex C was competed by the oligonucleotide containing the A-rich region mutation but not by the oligonucleotide containing the poly(C) mutation, indicating that complex C binds with high specificity to the pac1 poly(C) region. We conclude that three protein complexes interact with two distinct sequence motifs within the mCMV pac1 sequence with a high degree of sequence specificity. Both the poly C and the A rich motifs bind cellular proteins, whereas the A-rich motif is associated with a viral protein or a cellular protein upregulated by viral infection. A cleavage site containing a the A-rich region mutation was cleaved efficiently in the context of the viral genome (McVoy and Mocarski, this meeting), suggesting that the viral or cellular proteins in complexes A and B, which bind to the A-rich region, do not function in cleavage. The importance of the poly C region has not been ascertained in this system. The high degree of sequence conservation suggests that the A-rich motif, and the proteins which bind to it, play an important role in viral replication. Studies to evaluate the role of this region in circularization are underway.
An infected cell protein complex binds specifically to a murine cytomegalovirus cis DNA element essential for concatemer cleavage
Daniel E. Nixon, Michael McVoy, and
Stuart P. Adler.
6th International CMV Workshop,
Orange Beach Alabama. 1997
The proteins required for herpesvirus concatemer cleavage are unknown; however two sequence elements, pac1 and pac2, are conserved at herpesvirus termini and may be binding sites for these proteins. Viral and cellular proteins bind to herpes simplex virus and human cytomegalovirus pac2 sequences but an association between in vitro binding and cleavage has not been demonstrated. Using double stranded oligonucleotide probes in gel mobility shift assays, we identified four protein-DNA binding complexes (designated A, B, C1, and C2) binding to a murine cytomegalovirus (mCMV) pac1 containing probe and two complexes (D and E) binding to a pac2 containing probe. Complex D was only detected in extracts from infected cells. The remaining complexes were detected in uninfected cells. Using competitor oligonucleotides with 4-6 bp mutations in additional gel shift experiments, the binding domain of each complex was mapped. The binding site for complex C1 competed for complex E binding and vice versa, suggesting that C1 and E are the same cellular complex which binds to both sides of the cleavage site. The D complex binding site mapped to the pac2 A-rich region. Two mutations which disrupted D complex binding in gel shift assays, when introduced to an ectopic cleavage site in mCMV, blocked cleavage at the ectopic site. Our experiments suggest that the proteins in complex D are required for cleavage. Recombinant viruses containing ectopic sites with mutations that block binding of the other complexes are being analyzed.
cis sequences mediating guinea pig cytomegalovirus (gpCMV) genome cleavage
Michael McVoy, Daniel E. Nixon, and
Stuart P. Adler
6th International CMV Workshop,
Orange Beach Alabama. 1997
Cleavage of gpCMV replicative concatemeric DNA occurs at one of two nearby sites which share repeated sequences on one side of the cleavage point but differ on the other. Therefore sequence elements essential for cleavage should be conserved within the regions which are different at the two sites. To test this we cloned and sequenced the ends of gpCMV virion DNA and reconstructed the sequences of the cleavage sites. One of the two cleavage sites was flanked by typical herpesvirus conserved sequences called pac1 and pac2 which may mediate cleavage. The region containing pac1 was the same at both cleavage sites. The region containing pac2 differed at the 2nd site but contained two homologous sequence elements. The 1st element had 6 identical bases 7 bp from the termini. The same 6 bp were also 7 bp from the termini of rat and murine CMVs but were not in other herpesviruses. The 2nd element had 9 of 11 bases identical to the pac2 region of the 1st site. When these homologous elements were displaced from the point of cleavage by insertion of a foreign gene in a recombinant virus, cleavage did not occur. When 64 bp of sequence which included the 6 bp and 11 bp elements was restored between the foreign gene and the cleavage point, cleavage occurred, demonstrating that cis cleavage elements exist within this 64 bp. As the 11 bp element corresponds to pac2, which is highly conserved at all herpesvirus termini, we propose that the 11 bp element is the essential cis cleavage element. If the 6 bp element is also involved in cleavage, it is unique to rodent CMVs.
Tetracycline regulation of reporter gene expression within the human cytomegalovirus genome
Michael A. McVoy and Edward S. Mocarski
22nd International Herpesvirus Workshop,
San Diego California. 1997
Regulation of viral gene expression
through an inducible promoter such as the tetracycline-inducible system1
would be a highly desirable tool for investigating viral gene function
since complementing cell lines would not be needed and gene expression
could be regulated in a conditional manner during the replication cycle.
To investigate tetracycline (Tc) promoter regulation in the context of
the human cytomegalovirus (HCMV) genome, we made three recombinant viruses
containing luciferase under the control of different promoters: Phcmv*-1,
which has seven copies of the Tc operator upstream of a TAATA containing
element from -53 to +75 of the HCMV IE1/IE2 promoter1;
P1125, which has a TAATA element from the adenovirus
major late promoter in place of the HCMV TAATA; and P1129,
which has a single Tc opertator upstream of the HCMV TAATA. Tc regulation
of luciferase levels was evaluated when these viruses were used to infect
human fibroblasts that stably expressed tTA, a transactivator necessary
for Tc regulation1. At 72 hours post infection,
Tc most strongly repressed the P1125 promoter, resulting
in luciferase levels 50-fold lower than in the absence of Tc. Expression
from the Phcmv*-1 and P1129 promoters
was less well regulated, resulting in 10- and 2-fold differences, respectively,
between luciferase levels in Tc treated and untreated infected cells. These
results suggest that the P1125 promoter may provide
sufficient conditional expression of viral gene products to assess their
roles in viral replication.
1Gossen, M. and H. Bujard. 1992. PNAS 89:5547-5551
Guinea pig cytomegalovirus has two mechanisms of concatemer cleavage one duplicates the terminal repeat, the other does not
Daniel E. Nixon and Michael A. McVoy
22nd International Herpesvirus Workshop,
San Diego California. 1997
Sequence data from herpes simplex virus type-1 (HSV-1) and other herpesviruses suggest that cleavage of progeny genomes from replicative concatemers occurs by a single base staggered- cut, but because HSV-1 has at least one copy of the terminal repeat, or a sequence, at each end, this mechanism requires that cleavage occur between two a sequences. Junctions between genomes in HSV-1 concatemers, however, predominantly contain single a sequences. This, and the observation that single a sequences become amplified when introduced to ectopic locations in the HSV-1 genome or when used to generate amplicons, has led to the suggestion that cleavage duplicates terminal repeats. Guinea pig cytomegalovirus (GPCMV) has two genome structures: type I genomes have one repeat at the left end but lack a repeat at the right end; type II genomes have a single repeat at each end. Junctions within GPCMV concatemeric DNA contained both single and double repeats, such that type I genomes could arise from staggered-cut cleavage adjacent to single repeats and type II genomes could arise from staggered-cut cleavage between double repeats; however, the 1:1 ratio of type I to type II genomes did not correspond with the 4:1 ratio of single to double repeats in concatemeric DNA. A recombinant GPCMV that formed only type II genomes had only single repeats in its concatemeric DNA, indicating that for this virus, cleavage must duplicate the terminal repeat. A total absence of termini lacking a repeat in infected cell DNA suggests that this is not simply a consequence of alternate genomes being cleaved from the concatemer. Thus, although cleavage in GPCMV can occur by a staggered-cut mechanism, cleavage at single repeats can also occur by a mechanism that duplicates the repeat.
The direction of herpesvirus DNA concatemer cleavage/packaging is associated with pac2 cis cleavage/packaging elements.
Michael A. McVoy, Daniel E. Nixon,
and Jae K. Hur.
FASEB Summer Research Conferences:
Virus Assembly. Saxon's River Vermont. 1998
Herpesviruses have large double stranded
linear DNA genomes that are formed by cleavage from complex concatemeric
intermediates. Cleavage leaves ends on concatemeric DNA
similar to one of the two genomic
termini but not the other1-5, suggesting
that, like bacteriophage l, herpesvirus cleavage/packaging occurs from
concatemer ends one genome at a time and proceeds only in one direction.
Directionality in l results from binding of the large subunit of terminase
to concatemer ends and association of this complex with the portal vertex
of phage proheads prior to initiation of packaging. If a similar
process occurs in herpesviruses, concatemer ends may contain binding sites
for proteins involved in initiation of packaging. The known herpesvirus
cleavage/packaging elements, pac1 and pac2, lie at opposite
ends of herpesvirus genomes, with the exception of human cytomegalovirus
(CMV), in which putative pac1 and pac2 elements are adjacent
at one end and absent from the other. Our previous work with human
CMV concatemers detected a predominance of ends which lack the putative
pac1
and pac21. More recent reports
for herpes simplex virus type 12-4 and
equine herpesvirus type 15 indicate that ends containing pac2 are
associated with concatemers. To strengthen the association of
pac2
with concatemer ends, we analyzed concatemeric DNA from murine CMV and
guinea pig CMV. In both cases, pac2 ends were found on concatemers
but pac1 ends were absent. Therefore, in four different herpesviruses,
concatemers contain pac2 ends but lack
pac1 ends, suggesting
that pac2 is associated with the directionality of cleavage/packaging
and, by analogy to phage l, may bind to specific protein factors to mediate
initiation of packaging.
1McVoy,
M. A. and S. P. Adler. 1994. J.Virol. 68:1040-1061. 2Martinez,
R., R. Sarisky, P. Webber, and S. K. Weller. 1996. J.Virol. 70:2075-2085.
3Severini,
A., A. R. Morgan, D. R. Tovell, and D. L. J. Tyrrell. 1994. Virology 200:428-436.
4Zhang,
X., S. Efstathiou, and A. 9Simmons. 1994. Virology 202:530-539. 5Slobedman,
B. and A. Simmons. 1997. Virology 229:415-420.
Head-full restriction of genome cleavage/packaging in murine cytomegalovirus (MCMV): a defense against defective genomes?
Carlos Berbes and Michael A. McVoy
23rd International Herpesvirus Workshop,
York UK. 1998
Herpesviruses have large linear DNA genomes that are formed by cleavage of concatemeric intermediates at specific cleavage sites. An additional head-full restriction has also been proposed for viruses such as herpes simplex virus and human cytomegalovirus, based on the presence of uncleaved internal cleavage sites within their genomes and the preferential packaging of genome length amplicon DNAs containing uncleaved cleavage sites. When we introduced a functional second cleavage site into the MCMV genome, which does not normally contain internal cleavage sites, the normal viability of these viruses suggested that, to some extent, a head-full mechanism selects alternate cleavage sites in the concatemer in order to package complete viable genomes. To determine the degree to which cleavage at consecutive cleavage sites in these viruses produces subgenomic fragments, we used field-inversion gel electrophoresis to separate DNAs from infected cells and virions, then detected viral DNAs by hybridization. In both intracellular and virion DNAs, the smallest distinct fragments detected were genomic length (230 kb). Subgenomic fragments of 188 and 42 kb, predicted from cleavage at consecutive cleavage sites, were not detected. We conclude that cleavage/packaging in MCMV is tightly regulated by a head-full component. The necessity of this in a virus that normally lacks internal cleavage sites is not known; however, one function may be to block packaging of defective DNA that has undergone significant deletions.
The cleavage inhibitor BDCRB alters the equilibrium of cleavage from staggered-cut to terminal repeat duplication in both guinea pig cytomegalovirus (GPCMV) and human cytomegalovirus (HCMV)
Daniel E. Nixon, Jae K. Hur, and
Michael A. McVoy
23rd International Herpesvirus Workshop,
York UK. 1998
The mechanism of herpesvirus genome cleavage is poorly understood. BDCRB (2-bromo-5,6-dichloro-1-b-D-riborfuranosyl benzimidazole riboside) has been reported to inhibit these processes in HCMV by unknown mechanisms. In previous studies, we demonstrated that GPCMV uses two pathways for cleavage which can be differentiated on the basis of the termini formed. Staggered-cut cleavage generates termini which lack a repeat, while duplication cleavage generates termini containing one repeat. Here, we report that high dose BDCRB (50 mM) decreased GPCMV titers by 3 logs and inhibited both pathways. Lower doses (5 mM) reduced viral titers only O.5 log but selectively inhibited formation of termini lacking a repeat when assayed by Southern hybridization. Similarly, at very early times without BDCRB, there was an absence of concatemer termini lacking a repeat. When HCMV was cultured with BDCRB, an analogous loss of termini lacking a repeat was observed. To explain these results, we propose the following hypothesis: The two pathways exist in equilibrium. Initial stages that commit the process to duplication cleavage are not BDCRB sensitive and may be mediated by distinct proteins; however, both pathways share a final staggered-cut cleavage step that is inhibited by BDCRB. Partial inhibition of this step by low doses of BDCRB or at very early times when staggered-cut enzymes are present in limiting amounts shifts the equilibrium to favor the duplication pathway.
Evidence that a cellular DNA polymerase is involved in cleavage of human cytomegalovirus (HCMV) genomes from replicative concatemers
Michael A. McVoy
23rd International Herpesvirus Workshop,
York UK. 1998
Herpesviruses have large double stranded linear DNA genomes that are formed by cleavage of complex concatemeric intermediates. Previous studies have suggested that the terminal repeats found on some herpesvirus genomes may undergo duplication during cleavage. To ascertain whether a DNA polymerase is involved in the cleavage process and perhaps required for the duplication of terminal repeats, the effects of polymerase inhibitors on HCMV concatemer cleavage were determined. Cells were infected with HCMV in the presence of BDCRB, a drug which blocks cleavage but permits concatemer synthesis. The cells were washed on day 3 and cultured without BDCRB until day 5. DNAs from infected cells were separated by field-inversion gel electrophoresis and hybridized to detect HCMV DNAs. 230 kb genomic DNAs were absent on day 3 but present on day 5, indicating that removal of BDCRB permitted cleavage to proceed. Addition of phosphonoformic acid (PFA), a herpesvirus DNA polymerase specific inhibitor, after BDCRB removal (days 3 to 5) had little effect on cleavage; whereas addition of aphidicolin, an inhibitor of host polymerases a, e, and d, as well as HCMV DNA polymerase, virtually eliminated cleavage. These results suggest that HCMV DNA polymerase is not involved in cleavage but that an aphidicolin-sensitive, PFA-resistant polymerase, possibly DNA polymerase a, e, or d, may be required for HCMV cleavage.
Evidence that human cytomegalovirus DNA cleavage involves a cellular DNA polymerase
Michael A. McVoy
7th International CMV Workshop, Bristol UK. 1999
Duplication of human cytomegalovirus terminal a sequences occurs during replication and may be integral to cleavage and packaging of viral DNA. We hypothesized that DNA synthesis may be required for a sequence duplication and therefore involved in cleavage. The effects of DNA polymerase inhibitors on cleavage were assessed by blocking cleavage in infected cells with the inhibitor BDCRB while allowing accumulation of concatemers. Resumption of cleavage was then measured by detection of 230 kb genomes 24 h after BDCRB removal. Drugs that selectively inhibited the viral DNA polymerase (PFA, HPMPA, and PMEA) did not block cleavage when added after BDCRB was removed, whereas drugs that also inhibited host DNA synthesis (aphidicolin and PMEG) fully blocked cleavage, as did a high dose of PFA sufficient to block host synthesis. Likewise, cleavage was fully blocked by a dose of DHPG predicted to inhibit host polymerases in infected cells. These results suggest that the viral DNA polymerase is not involved in cleavage but that an aphidicolin-sensitive DNA polymerase such as host DNA polymerases a,d, or e may be required for cleavage.
Dramatic effects of the maturational inhibitor BDCRB on herpesvirus genome structure and packaging
Michael A. McVoy and Daniel E. Nixon
FASEB Summer Research Conferences:
Virus Assembly. Saxon's River Vermont. 2000
Herpesviruses are believed to replicate their DNA as long linear concatemers that must be packaged into capsids and cleaved at specific sequences. Using guinea pig cytomegalovirus (GPCMV) as a model to study herpesvirus genome packaging, we have shown that concatemer cleavage is a result of two events leading to two genome types. One event duplicates the GPCMV terminal repeat and results in genomes with a repeat at each end. The other simply cleaves the DNA such that the right end of the genome lacks a terminal repeat. BDCRB (2-bromo-5,6-Dichloro-1-b-D-ribofuranosyl benzimidazole riboside) has been reported to inhibit the formation of 230-kb unit length human cytomegalovirus genomes by unknown mechanisms. We have shown that GPCMV is also sensitive to BDCRB (IC50=5 mM) and, at moderate doses, increases the proportion of genomes and concatemer termini that have the right terminal repeat. Here, we report that high dose BDCRB (50 mM, sufficient to reduce GPCMV titers by 3 logs) had no effect on the amount of intracellular 230 kb DNA. This DNA, however, was fully nuclease-sensitive and lacked 5- to 7-kb of sequence from the left end of the viral genome, the last end to be packaged. Electron microscopy demonstrated that DNA was in fact packaged within capsids in BDCRB-treated GPCMV-infected cells, however, the packaged DNA was sensitive to addition of nuclease. These data suggest that BDCRB induces premature cleavage events that result in truncated genomes packaged within capsids that are permeable to nuclease. Based on these and other observations, we propose a model for duplication of herpesvirus terminal repeats during the cleavage/packaging process that is similar to one proposed for bacteriophage T7 (Chung et al. J Mol Biol 1990. 216: 939).
HIGH LEVELS OF SERUM ANTIBODY TO HUMAN CYTOMEGALOVIRUS (HCMV) pUL89 ARE ASSOCIATED WITH SEVERE PRIMARY HCMV INFECTION DURING PREGNANCY
Jian Ben Wang, Giovanni Nigro, Michael A. McVoy, and Stuart P. Adler.
25th International Herpesvirus Workshop. Portland OR, 2000.
Congenital HCMV infection resulting from primary infection during pregnancy is a significant cause of birth defects, and diagnostic tools to identify women at risk for congenital infection are greatly needed. To evaluate the use of recombinant HCMV pUL89 in serologic assays, a GST-6xHis-pUL89 fusion protein containing the C-terminal third of pUL89 was expressed in E. coli. Recombinant protein was purified by Ni-column chromatography and polyacrylamide gel electrophoresis, then used in an enzyme-linked immunosorbent assay (ELISA). Twenty three sera were tested from women who had primary HCMV infections during pregnancy, as assessed by IgM, viral culture, and PCR. Of the 23 infants born to these women, 12 had evidence of HCMV infection and 6 manifested severe HCMV disease. High levels of reactivity to rpUL89 were detected in 22 of the 23 primary infection sera (mean O.D. = 1.02). In contrast, 22 sera from pregnant subjects with recurrent HCMV infections, 20 sera from pregnant seropositive subjects with no evidence of HCMV infection, and 23 sera from normal seropositive subjects reacted weakly with the pUL89 antigen (mean O.D. = 0.29). The same sera were tested in ELISA assays using pUL89 antigen expressed from recombinant baculovirus infected insect cells or from stably transformed NIH3T3 cells; a correlation of reactivity was found between the three recombinant pUL89 antigens. Thus, detection of antibodies to pUL89 may provide a valuable serologic marker for severe primary HCMV infection during pregnancy.
RAPID INSERTION OF DNA SEQUENCES TO A BACMID-CLONED HERPESVIRUS GENOME USING Tn7-MEDIATED TRANSPOSITION
Carlos Berbes, Gabriele Hahn, and Michael A. McVoy
25th International Herpesvirus Workshop. Portland OR, 2000.
Genetic engineering of herpesvirus genomes has traditionally used homologous recombination in eukaryotic cells. The availability of bacmid-cloned herpesvirus genomes now provides a variety of advantages: lack of contamination and recombination with wild-type virus and the opportunity to use the well developed genetic systems of E. coli. However, manipulation of bacmids has its difficulties. In particular, the need to use plasmids with temperature sensitive origins and cointegrate formation and resolution. We have adapted a system developed by Luckow et al. (Luckow et al., J. Virol. 1993. 67:4566) to use Tn7-mediated transposition to rapidly introduce new DNA sequences into a specific locus within a bacmid-cloned murine cytomegalovirus genome. These new sequences are cloned within a small (4 kb) easily manipulatable shuttle plasmid. Upon transformation of bacteria containing the target bacmid, the new sequences are efficiently transposed into the target bacmid, and the desired clones are readily identified by blue/white screening. Thus, construction of recombinant viruses is reduced to manipulation of sequences within a small plasmid and the desired viral genomes can be isolated following an overnight transformation. We will present viruses constructed by this method containing as an insertion the enhanced green fluorescent protein gene or ectopic cleavage sites. The former allows for visual identification in cell culture; the latter will be used for mutagenic analysis of cis-acting cleavage/packaging sequences.
RAPID CONSTRUCTION OF A RECOMBINANT HERPESVIRUS USING A BIFUNCTIONAL FUSION PROTEIN EXPRESSING GREEN FLUORESCENT PROTEIN AND PUROMYCIN RESISTANCE
Juan C. Lacayo, Mark Prichard, and Michael A. McVoy
25th International Herpesvirus Workshop. Portland OR, 2000
Construction of recombinant herpesviruses by homologous recombination has utilized both visual and selectable markers. Enhanced green fluorescent protein (EGFP) is nontoxic and can be visualized in individual cells or sorted by flow cytometry. Puromycin-N-acetyl transferase (Pac) confers resistance to puromycin, a highly potent and inexpensive antibiotic. To combine the features of both markers within a single protein, the coding sequences for EGFP were fused with those for Pac (EGFP-puro). When expressed using the human cytomegalovirus immediate early promoter and SV40 polyadenylation signal, the EGFP-puro protein is readily detected by fluorescence microscopy and confers puromycin resistance. This small (2.2 kb) cassette was inserted into a plasmid containing guinea pig cytomegalo-virus (GPCMV) sequences from the right end of the genome. The resulting plasmid was linearized and electroporated into guinea pig lung (GPL) fibroblasts. Twenty-four hours later the cells were infected with GPCMV. After five days the supernatant was used to infect a confluent flask of GPL cells. Green cells were visible within 24 hours, indicating the presence of recombinant virus. After a second passage with selection, 96-well limiting dilution was used to purify the recombinant virus. This system greatly enhances the ease of recombinant virus construction by the powerful selection of puromycin and the convenient detection of recombinant virus infected cells during the 96-well limited dilution process.
DRAMATIC EFFECTS OF THE MATURATIONAL INHIBITOR BDCRB ON GENOME STRUCTURE AND PACKAGING OF GUINEA PIG CYTOMEGALOVIRUS
Daniel E. Nixon and Michael A. McVoy
25th International Herpesvirus Workshop. Portland OR, 2000
Using guinea pig cytomegalovirus (GPCMV) as a model, we have shown that concatemer cleavage is a result of two events leading to two genome types. One event duplicates the GPCMV terminal repeat and results in genomes with a repeat at each end. The other simply cleaves the DNA such that the right end of the genome lacks a terminal repeat. BDCRB (2-bromo-5,6-Dichloro-1-b-D-ribofuranosyl benzimidazole riboside) has been reported to inhibit the formation of 230-kb unit length human cytomegalovirus genomes by unknown mechanisms. We have shown that GPCMV is also sensitive to BDCRB (IC50=5 mM) and, at moderate doses, increases the proportion of genomes and concatemer termini that have the right terminal repeat. Here, we report that high dose BDCRB (50 mM, sufficient to reduce GPCMV titers by 3 logs) had no effect on the amount of intracellular 230 kb DNA. This DNA, however, was fully nuclease-sensitive and lacked 5- to 7-kb of sequence from the left end of the viral genome, the last end to be packaged. Electron microscopy demonstrated that DNA was in fact packaged within capsids in BDCRB-treated GPCMV-infected cells, however, the packaged DNA was sensitive to addition of nuclease. These data suggest that BDCRB induces premature cleavage events that result in truncated genomes packaged within capsids that are permeable to nuclease. Based on these and other observations, we propose a model for duplication of herpesvirus terminal repeats during the cleavage/packaging process that is similar to one proposed for bacteriophage T7 (Chung et al. J Mol Biol 1990. 216: 939).
MHC Class I Down-Regulation by Guinea Pig Cytomegalovirus
Juan C. Lacayo and Michael A. McVoy
8th International Cytomegalovirus Workshop. Pacific Grove CA, 2001
Cytomegaloviruses have evolved an extensive genetic repertoire to subvert major histocompatibility class I functions, evade host immune activation, and cytotoxic T-cell recognition. Human cytomegalovirus has four different genes that inhibit class I expression at various points of assembly and transport of class I to the cell surface (Jones et al. 1995. J. Virol. 69:4830-41). Removal of these genes has the potential to improve the efficacy of live attenuated CMV vaccines by enhancing antigen presentation; however, testing this hypothesis in humans may be precluded by safety and cost considerations. Guinea pig cytomegalovirus (GPCMV) has been used to model several aspects of human cytomegalovirus infections, including mononucleosis, interstitial pneumonia, and congenital transmission, however, down-regulation of class I by GPCMV has not been studied in these models. Therefore, to determine if GPCMV down-regulates class I we constructed a green fluorescent protein-tagged GPCMV and used flow cytometry to analyze expression of class I on the surface of infected and uninfected guinea pig embryonic fibroblasts. Infected cells (expressing green fluorescence) underwent a 5-8 fold reduction in surface class I. Down-regulation was infected-cell specific since uninfected cells in the same cultures showed no change in surface class I levels. Down-regulation was observed as early as six hours post infection and class I was maximally suppressed by 48 hours. Further analysis of the genes involved in class I down-regulation by GPCMV should permit the use of the guinea pig model to evaluate the effects of class I down-regulation on vaccine efficacy.
1. Please include postal mailing
address.
2. Please include the title of the
reprint you are requesting.
Note: Reprints
are not availabe for publications listed as "submitted."
click
here to email a reprint request
VCU
Homepage
Date Last Modified: June 6, 2001
This page was created by Anupam
Bapu Jena in loving memory of budi-ma and buda-baba, and in honor of tutu
bhai and the entire family.
This page does not reflect an official position of the Medical College of Virginia/Virginia Commonwealth University.
