Rules of the game
Jeff Elhai 289-8412 JElhai@Richmond.Edu
Brad Goodner 289-8661 BGoodner@Richmond.Edu
Margie Lhamon 662-3210 MLhamon@Richmond.Edu
Sylvie Ho 662-3311 THo@Richmond.Edu
The Questions
1. What is the maximum number of amino acids that could be encoded by a nonoverlapping four-letter code?
2. What would you predict to be the results if a smooth strain of Pneumococcus (infectious) is heat-killed, ground up, subjected to nuclease (which destroys DNA) and coinjected into a mouse along with a live rough strain of Pneumococcus (noninfectious)?
3. The following is a small part of the actual sequence of the mRNA that encodes human globin (one of two proteins that make up hemoglobin. Below it is a small part of the actual sequence of the mRNA that encodes human globin in people with sickle cell anemia. What is the defect in the globin protein of people with sickle cell anemia? Describe how you know this. The mutation is near the beginning of the gene, which begins with the usual start (methionine) codon present in the given sequence.
| normal | CUAGCAACCUCAAACAGACACCAUGGUGCACCUGACUCCUGAGGAGAAGUCUGCCG |
| sickle | CUAGCAACCUCAAACAGACACCAUGGUGCACCUGACUCCUGUGGAGAAGUCUGCCG |
4. Deduce everything you can from the following experiments designed to elucidate the genetic code of a weird organism. Give reasons for your conclusions (briefly, please!). In each experiment, synthetic RNA was translated by cell extract from the organism.
Expt 1. Synthetic RNA GACGACGACGACGACGAC yields three products:
ArgArgArgArgArg
LysLysLysLysLys
SerSerSerSerSer
Expt 2. Synthetic RNA AGAGAGAGAGAGAG yields two products:
TyrTyrTyrTyrTyr
PhePhePhePhePhe
5. You are the CEO of a major textile manufacturing firm. An obscure member of your research department has burst into your office and demanded to show you some new results he has obtained. He is disheveled and out of breath but manages to get out that he has found a chemical extracted from a flower that is so sweet smelling that it quiets the mind and makes it susceptible to suggestion. You're inclined to throw the rascal out but there's something about the flask he's carrying that makes you want to hear more. So maybe it works.
We will put the aroma in the cloth we produce, he says, and revolutionize the garment industry! Unfortunately, the flower grows only on the peaks of Tibet, or in Tibetan soil imported at great expense to the laboratory (so that's the reason for the high research costs this past year!). It's clearly impractical to grow enough of it to get the chemical in the large amounts required by his plan. Instead, he has spent his time making mutants of the flower, hoping to understand the biochemical pathway by which the chemical is made. If he learns the identities of the enzymes required for the chemical's synthesis, he could clone the genes and put them in cotton, building the aroma right into the fiber!
Accordingly, he has analyzed the mutant flowers (those that lack the aroma) and found four chemicals that accumulates in the mutants. Furthermore, he has added these chemicals back to mutant flowers and noted whether they thereby regain the ability to make the aroma. The short of it is, he's finally found the answer, and we live in a brave new world!
Well, you've had quite enough of this nonsense but maybe he's on to something. You are not your normally decisive self. You decide that you're going to have a look at the data and see for yourself what the truth of the matter is.
|
|
|||||
|
|
|
(sweet) |
(toasty) |
(oily) |
|
|
Normal Mutant #1 Mutant #2 Mutant #3 |
|
|
|
|
|
From this information, deduce the biochemical pathway that produces the remarkable aroma and what step in the pathway is defective in each mutant.